Human DDIT3 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human DDIT3 cDNA Clone in Mammalian Expression Vector (ABIN3319743)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc324377
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human DDIT3 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "C/EBP homologous protein drives pro-catabolic responses in chondrocytes." in: Arthritis research & therapy, Vol. 15, Issue 6, pp. R218, (2014) (PubMed).
: "Mechanistic elucidation of the antitumor properties of withaferin a in breast cancer." in: Cancer research, Vol. 74, Issue 9, pp. 2617-29, (2014) (PubMed).
: "Suppression of PP2A is critical for protection of melanoma cells upon endoplasmic reticulum stress." in: Cell death & disease, Vol. 3, pp. e337, (2012) (PubMed).
-
: "C/EBP homologous protein drives pro-catabolic responses in chondrocytes." in: Arthritis research & therapy, Vol. 15, Issue 6, pp. R218, (2014) (PubMed).
-
- DDIT3 (DNA-Damage-Inducible Transcript 3 (DDIT3))
-
Alternative Name
- DDIT3
-
Background
- This gene encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. The protein functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members, such as C/EBP and LAP (liver activator protein), and preventing their DNA binding activity. The protein is implicated in adipogenesis and erythropoiesis, is activated by endoplasmic reticulum stress, and promotes apoptosis. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in myxoid liposarcomas or Ewing sarcoma. Multiple alternatively spliced transcript variants encoding two isoforms with different length have been identified. [provided by RefSeq, Aug 2010].Transcript Variant: This variant (5) lacks an internal segment in the 5' region, resulting in a downstream AUG start codon, as compared to variant 1. The resulting isoform (2) is shorter at the N-terminus, as compared to isoform 1.
-
NCBI Accession
- NM_004083, NP_004074
Target
-