Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human HOXA9 cDNA Clone in Mammalian Expression Vector

This is a Homeobox A9 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3319944
Supplier Product No.: sc321224
$445.50
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human HOXA9 cDNA Clone in Mammalian Expression Vector (ABIN3319944)

Gene

HOXA9 (Homeobox A9 (HOXA9))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc321224

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human HOXA9 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Yu, Lee, Sohn, Lee, Jeon, Lee, Park, Lee, Yeom, Son, Yoon, Kang: "Homeobox A9 directly targeted by miR-196b regulates aggressiveness through nuclear Factor-kappa B activity in non-small cell lung cancer cells." in: Molecular carcinogenesis, Vol. 55, Issue 12, pp. 1915-1926, (2015) (PubMed).

    Artinger, Mishra, Zaffuto, Li, Chung, Moore, Chen, Cheng, Ernst: "An MLL-dependent network sustains hematopoiesis." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 110, Issue 29, pp. 12000-5, (2013) (PubMed).

  • Target

    HOXA9 (Homeobox A9 (HOXA9))

    Alternative Name

    HOXA9

    Background

    In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. This gene is highly similar to the abdominal-B (Abd-B) gene of Drosophila. A specific translocation event which causes a fusion between this gene and the NUP98 gene has been associated with myeloid leukemogenesis. Read-through transcription exists between this gene and the upstream homeobox A10 (HOXA10) gene.[provided by RefSeq, Mar 2011].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).

    NCBI Accession

    NM_152739, NP_689952
You are here: