Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human KCNE1 cDNA Clone in Mammalian Expression Vector

This is a Potassium Voltage-Gated Channel, Isk-Related Family, Member 1 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3319984
Supplier Product No.: sc126888
$163.35
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 16 to 17 Business Days

Quick Overview for Human KCNE1 cDNA Clone in Mammalian Expression Vector (ABIN3319984)

Gene

KCNE1 (Potassium Voltage-Gated Channel, Isk-Related Family, Member 1 (KCNE1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc126888

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human KCNE1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Werry, Eldstrom, Wang, Fedida: "Single-channel basis for the slow activation of the repolarizing cardiac potassium current, I(Ks)." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 110, Issue 11, pp. E996-1005, (2013) (PubMed).

    Eldstrom, Xu, Werry, Kang, Loewen, Degenhardt, Sanatani, Tibbits, Sanders, Fedida: "Mechanistic basis for LQT1 caused by S3 mutations in the KCNQ1 subunit of IKs." in: The Journal of general physiology, Vol. 135, Issue 5, pp. 433-48, (2010) (PubMed).

  • Target

    KCNE1 (Potassium Voltage-Gated Channel, Isk-Related Family, Member 1 (KCNE1))

    Alternative Name

    KCNE1

    Background

    The product of this gene belongs to the potassium channel KCNE family. Potassium ion channels are essential to many cellular functions and show a high degree of diversity, varying in their electrophysiologic and pharmacologic properties. This gene encodes a transmembrane protein known to associate with the product of the KVLQT1 gene to form the delayed rectifier potassium channel. Mutation in this gene are associated with both Jervell and Lange-Nielsen and Romano-Ward forms of long-QT syndrome. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (2) is the longest transcript. All variants encode the same protein.

    NCBI Accession

    NM_000219, NP_000210
You are here: