Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human NUDT1 cDNA Clone in Mammalian Expression Vector

This is a Nudix (Nucleoside Diphosphate Linked Moiety X)-Type Motif 1 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: 800 bp. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3320107
Supplier Product No.: sc307824
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 21 to 22 Business Days

Quick Overview for Human NUDT1 cDNA Clone in Mammalian Expression Vector (ABIN3320107)

Gene

NUDT1 (Nudix (Nucleoside Diphosphate Linked Moiety X)-Type Motif 1 (NUDT1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc307824

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human NUDT1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    800 bp

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    NUDT1 (Nudix (Nucleoside Diphosphate Linked Moiety X)-Type Motif 1 (NUDT1))

    Alternative Name

    NUDT1

    Background

    Misincorporation of oxidized nucleoside triphosphates into DNA/RNA during replication and transcription can cause mutations that may result in carcinogenesis or neurodegeneration. The protein encoded by this gene is an enzyme that hydrolyzes oxidized purine nucleoside triphosphates, such as 8-oxo-dGTP, 8-oxo-dATP, 2-hydroxy-dATP, and 2-hydroxy rATP, to monophosphates, thereby preventing misincorporation. The encoded protein is localized mainly in the cytoplasm, with some in the mitochondria, suggesting that it is involved in the sanitization of nucleotide pools both for nuclear and mitochondrial genomes. Several alternatively spliced transcript variants, some of which encode distinct isoforms, have been identified. Additional variants have been observed, but their full-length natures have not been determined. A single-nucleotide polymorphism that results in the production of an additional, longer isoform (p26) has been described. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (2B) differs in the 5' UTR and 5' coding region compared to variant 1, resulting in translation initiation at an upstream ATG and an isoform (p22, also known as MTH1b) with a longer N-terminus compared to isoform p18. Variants 2B, 3B, and 4B encode the same isoform.

    NCBI Accession

    NM_198949, NP_945187
You are here: