Human PARP1 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human PARP1 cDNA Clone in Mammalian Expression Vector (ABIN3320132)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc119157
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human PARP1 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 3000 bp
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Aryl hydrocarbon receptor repressor and TiPARP (ARTD14) use similar, but also distinct mechanisms to repress aryl hydrocarbon receptor signaling." in: International journal of molecular sciences, Vol. 15, Issue 5, pp. 7939-57, (2014) (PubMed).
: "BAL1 and its partner E3 ligase, BBAP, link Poly(ADP-ribose) activation, ubiquitylation, and double-strand DNA repair independent of ATM, MDC1, and RNF8." in: Molecular and cellular biology, Vol. 33, Issue 4, pp. 845-57, (2013) (PubMed).
: "2,3,7,8-Tetrachlorodibenzo-p-dioxin poly(ADP-ribose) polymerase (TiPARP, ARTD14) is a mono-ADP-ribosyltransferase and repressor of aryl hydrocarbon receptor transactivation." in: Nucleic acids research, Vol. 41, Issue 3, pp. 1604-21, (2013) (PubMed).
: "Cooperative role of NF-{kappa}B and poly(ADP-ribose) polymerase 1 (PARP-1) in the TNF-induced inhibition of PHEX expression in osteoblasts." in: The Journal of biological chemistry, Vol. 285, Issue 45, pp. 34828-38, (2010) (PubMed).
: "Poly(ADP-ribose) polymerase-1 regulates vimentin expression in lung cancer cells." in: American journal of physiology. Lung cellular and molecular physiology, Vol. 293, Issue 5, pp. L1127-34, (2007) (PubMed).
-
-
- PARP1 (Poly (ADP-Ribose) Polymerase 1 (PARP1))
-
Alternative Name
- PARP1
-
Background
- This gene encodes a chromatin-associated enzyme, poly(ADP-ribosyl)transferase, which modifies various nuclear proteins by poly(ADP-ribosyl)ation. The modification is dependent on DNA and is involved in the regulation of various important cellular processes such as differentiation, proliferation, and tumor transformation and also in the regulation of the molecular events involved in the recovery of cell from DNA damage. In addition, this enzyme may be the site of mutation in Fanconi anemia, and may participate in the pathophysiology of type I diabetes. [provided by RefSeq, Jul 2008].
-
NCBI Accession
- NM_001618, NP_001609
Target
-