Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PARP1 cDNA Clone in Mammalian Expression Vector

This is a Poly (ADP-Ribose) Polymerase 1 plasmid from OriGene - 5 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: 3000 bp. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3320132
Supplier Product No.: sc119157
$1,457.50
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PARP1 cDNA Clone in Mammalian Expression Vector (ABIN3320132)

Gene

PARP1 (Poly (ADP-Ribose) Polymerase 1 (PARP1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc119157

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PARP1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3000 bp

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • MacPherson, Ahmed, Tamblyn, Krutmann, Förster, Weighardt, Matthews: "Aryl hydrocarbon receptor repressor and TiPARP (ARTD14) use similar, but also distinct mechanisms to repress aryl hydrocarbon receptor signaling." in: International journal of molecular sciences, Vol. 15, Issue 5, pp. 7939-57, (2014) (PubMed).

    Yan, Xu, Zhu, Cheng, Wang, Manis, Shipp: "BAL1 and its partner E3 ligase, BBAP, link Poly(ADP-ribose) activation, ubiquitylation, and double-strand DNA repair independent of ATM, MDC1, and RNF8." in: Molecular and cellular biology, Vol. 33, Issue 4, pp. 845-57, (2013) (PubMed).

    MacPherson, Tamblyn, Rajendra, Bralha, McPherson, Matthews: "2,3,7,8-Tetrachlorodibenzo-p-dioxin poly(ADP-ribose) polymerase (TiPARP, ARTD14) is a mono-ADP-ribosyltransferase and repressor of aryl hydrocarbon receptor transactivation." in: Nucleic acids research, Vol. 41, Issue 3, pp. 1604-21, (2013) (PubMed).

    Majewski, Thurston, Ramalingam, Kiela, Ghishan: "Cooperative role of NF-{kappa}B and poly(ADP-ribose) polymerase 1 (PARP-1) in the TNF-induced inhibition of PHEX expression in osteoblasts." in: The Journal of biological chemistry, Vol. 285, Issue 45, pp. 34828-38, (2010) (PubMed).

    Chu, Xu, Ferro, Rivera: "Poly(ADP-ribose) polymerase-1 regulates vimentin expression in lung cancer cells." in: American journal of physiology. Lung cellular and molecular physiology, Vol. 293, Issue 5, pp. L1127-34, (2007) (PubMed).

  • Target

    PARP1 (Poly (ADP-Ribose) Polymerase 1 (PARP1))

    Alternative Name

    PARP1

    Background

    This gene encodes a chromatin-associated enzyme, poly(ADP-ribosyl)transferase, which modifies various nuclear proteins by poly(ADP-ribosyl)ation. The modification is dependent on DNA and is involved in the regulation of various important cellular processes such as differentiation, proliferation, and tumor transformation and also in the regulation of the molecular events involved in the recovery of cell from DNA damage. In addition, this enzyme may be the site of mutation in Fanconi anemia, and may participate in the pathophysiology of type I diabetes. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_001618, NP_001609
You are here: