Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human POU2F1 cDNA Clone in Mammalian Expression Vector

This is a POU Domain, Class 2, Transcription Factor 1 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: 2500 bp. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3320182
Supplier Product No.: sc321473
$1,011.78
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human POU2F1 cDNA Clone in Mammalian Expression Vector (ABIN3320182)

Gene

POU2F1 (POU Domain, Class 2, Transcription Factor 1 (POU2F1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc321473

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human POU2F1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2500 bp

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • He, Qi, Jia, Wang, Wang, Song, Fu, Li, Luo: "Tumor cell-secreted angiogenin induces angiogenic activity of endothelial cells by suppressing miR-542-3p." in: Cancer letters, Vol. 368, Issue 1, pp. 115-25, (2015) (PubMed).

    Yamakawa, Hamada, Uchida, Sato, Yuki, Hayashi, Kawaguchi, Saito: "Distinct interaction of nilotinib and imatinib with P-Glycoprotein in intracellular accumulation and cytotoxicity in CML Cell Line K562 cells." in: Biological & pharmaceutical bulletin, Vol. 37, Issue 8, pp. 1330-5, (2014) (PubMed).

    Higashi, Imamura, Fudo, Uemura, Saiki, Hoshino, Toida, Kashiwagi, Igarashi: "Identification of functional amino acid residues involved in polyamine and agmatine transport by human organic cation transporter 2." in: PLoS ONE, Vol. 9, Issue 7, pp. e102234, (2014) (PubMed).

    Reichman, Kalathur, Lambard, Aït-Ali, Yang, Lardenois, Ripp, Poch, Zack, Sahel, Léveillard: "The homeobox gene CHX10/VSX2 regulates RdCVF promoter activity in the inner retina." in: Human molecular genetics, Vol. 19, Issue 2, pp. 250-61, (2009) (PubMed).

  • Target

    POU2F1 (POU Domain, Class 2, Transcription Factor 1 (POU2F1))

    Alternative Name

    POU2F1

    Background

    The OCT1 transcription factor was among the first identified members of the POU transcription factor family (summarized by Sturm et al., 1993 [PubMed 8314572]). Members of this family contain the POU domain, a 160-amino acid region necessary for DNA binding to the octameric sequence ATGCAAAT.[supplied by OMIM, Jul 2010].Transcript Variant: This variant (1) encodes the longest isoform (1).

    NCBI Accession

    NM_002697, NP_002688
You are here: