Human PRKAR1A cDNA Clone in Mammalian Expression Vector
This is a Protein Kinase, CAMP-Dependent, Regulatory, Type I, alpha (Tissue Specific Extinguisher 1) plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
Catalog No. ABIN3320193
Supplier Product No.: sc324669
$452.43
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human PRKAR1A cDNA Clone in Mammalian Expression Vector (ABIN3320193)
Gene
PRKAR1A
(Protein Kinase, CAMP-Dependent, Regulatory, Type I, alpha (Tissue Specific Extinguisher 1) (PRKAR1A))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-AC
Promoter
Enhanced CMV Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient, Stable
-
-
Species
- Human
-
Supplier Product No.
- sc324669
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human PRKAR1A is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- PRKAR1A (Protein Kinase, CAMP-Dependent, Regulatory, Type I, alpha (Tissue Specific Extinguisher 1) (PRKAR1A))
-
Alternative Name
- PRKAR1A
-
Background
- CAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. This gene encodes one of the regulatory subunits. This protein was found to be a tissue-specific extinguisher that down-regulates the expression of seven liver genes in hepatoma x fibroblast hybrids. Mutations in this gene cause Carney complex (CNC). This gene can fuse to the RET protooncogene by gene rearrangement and form the thyroid tumor-specific chimeric oncogene known as PTC2. A nonconventional nuclear localization sequence (NLS) has been found for this protein which suggests a role in DNA replication via the protein serving as a nuclear transport protein for the second subunit of the Replication Factor C (RFC40). Several alternatively spliced transcript variants encoding two different isoforms have been observed. [provided by RefSeq, Jan 2013].Transcript Variant: This variant (1) contains an alternate exon in place of the first 5' UTR exon compared to variant 2. Variants 1, 2, 3, 4, and 6 all encode the same isoform (a).
-
NCBI Accession
- NM_002734, NP_002725
Target
-
You are here:
