Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human RASSF5 cDNA Clone in Mammalian Expression Vector

This is a Ras Association (RalGDS/AF-6) Domain Family Member 5 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3320228
Supplier Product No.: sc324315
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human RASSF5 cDNA Clone in Mammalian Expression Vector (ABIN3320228)

Gene

RASSF5 (Ras Association (RalGDS/AF-6) Domain Family Member 5 (RASSF5))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc324315

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human RASSF5 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Donninger, Clark, Monaghan, Schmidt, Vos, Clark: "Cell cycle restriction is more important than apoptosis induction for RASSF1A protein tumor suppression." in: The Journal of biological chemistry, Vol. 289, Issue 45, pp. 31287-95, (2014) (PubMed).

    Schmidt, Donninger, Clark: "Ras regulates SCF(β-TrCP) protein activity and specificity via its effector protein NORE1A." in: The Journal of biological chemistry, Vol. 289, Issue 45, pp. 31102-10, (2014) (PubMed).

  • Target

    RASSF5 (Ras Association (RalGDS/AF-6) Domain Family Member 5 (RASSF5))

    Alternative Name

    RASSF5

    Background

    This gene is a member of the Ras association domain family. It functions as a tumor suppressor, and is inactivated in a variety of cancers. The encoded protein localizes to centrosomes and microtubules, and associates with the GTP-activated forms of Ras, Rap1, and several other Ras-like small GTPases. The protein regulates lymphocyte adhesion and suppresses cell growth in response to activated Rap1 or Ras. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (3), also known as transcript B, differs in the 5' UTR, lacks a portion of the 5' coding region, and intiates translation at an alternate start codon, compared to variant 1. The resulting isoform (C), also known as NORE1B, is shorter and has a distinct N-terminus when compared to isoform A.

    NCBI Accession

    NM_182665, NP_872606
You are here: