Human RASSF5 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human RASSF5 cDNA Clone in Mammalian Expression Vector (ABIN3320228)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc324315
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human RASSF5 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Cell cycle restriction is more important than apoptosis induction for RASSF1A protein tumor suppression." in: The Journal of biological chemistry, Vol. 289, Issue 45, pp. 31287-95, (2014) (PubMed).
: "Ras regulates SCF(β-TrCP) protein activity and specificity via its effector protein NORE1A." in: The Journal of biological chemistry, Vol. 289, Issue 45, pp. 31102-10, (2014) (PubMed).
-
: "Cell cycle restriction is more important than apoptosis induction for RASSF1A protein tumor suppression." in: The Journal of biological chemistry, Vol. 289, Issue 45, pp. 31287-95, (2014) (PubMed).
-
- RASSF5 (Ras Association (RalGDS/AF-6) Domain Family Member 5 (RASSF5))
-
Alternative Name
- RASSF5
-
Background
- This gene is a member of the Ras association domain family. It functions as a tumor suppressor, and is inactivated in a variety of cancers. The encoded protein localizes to centrosomes and microtubules, and associates with the GTP-activated forms of Ras, Rap1, and several other Ras-like small GTPases. The protein regulates lymphocyte adhesion and suppresses cell growth in response to activated Rap1 or Ras. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (3), also known as transcript B, differs in the 5' UTR, lacks a portion of the 5' coding region, and intiates translation at an alternate start codon, compared to variant 1. The resulting isoform (C), also known as NORE1B, is shorter and has a distinct N-terminus when compared to isoform A.
-
NCBI Accession
- NM_182665, NP_872606
Target
-