Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human SNURF cDNA Clone in Mammalian Expression Vector

This is a SNRPN Upstream Reading Frame plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3320319
Supplier Product No.: sc321393
$148.50
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human SNURF cDNA Clone in Mammalian Expression Vector (ABIN3320319)

Gene

SNURF (SNRPN Upstream Reading Frame (SNURF))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc321393

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human SNURF is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    SNURF (SNRPN Upstream Reading Frame (SNURF))

    Alternative Name

    SNURF

    Background

    This gene encodes a highly basic protein localized to the nucleus. The evolutionarily constrained open reading frame is found on a bicistronic transcript which has a downstream ORF encoding the small nuclear ribonucleoprotein polypeptide N. The upstream coding region utilizes the first three exons of the transcript, a region that has been identified as an imprinting center. Multiple transcription initiation sites have been identified and extensive alternative splicing occurs in the 5' untranslated region but the full-length nature of these transcripts has not been determined. An alternate exon has been identified that substitutes for exon 4 and leads to a truncated, monocistronic transcript. Alternative splicing or deletion caused by a translocation event in the 5' UTR or coding region of this gene leads to Angelman syndrome or Prader-Willi syndrome due to parental imprint switch failure. The function of this protein is not yet known. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) includes exons 1-10 in a bicistronic transcript that also contains a downstream open reading frame for the SNRPN gene. This longer transcript is the predominant form, although the monocistronic and bicistronic transcripts encode identical proteins, with alternate splicing occurring only in the 3' UTR.

    NCBI Accession

    NM_005678, NP_005669
You are here: