Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human SUMO1 cDNA Clone in Mammalian Expression Vector

This is a Small Ubiquitin Related Modifier Protein 1 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3320340
Supplier Product No.: sc321415
$148.50
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 8 Business Days

Quick Overview for Human SUMO1 cDNA Clone in Mammalian Expression Vector (ABIN3320340)

Gene

SUMO1 (Small Ubiquitin Related Modifier Protein 1 (SUMO1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc321415

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human SUMO1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Kim, Lee, Song, Kwon, Lee, Pan, Kwon: "A monoclonal antibody against the human SUMO-1 protein obtained by immunization with recombinant protein and CpG-DNA-liposome complex." in: Monoclonal antibodies in immunodiagnosis and immunotherapy, Vol. 32, Issue 5, pp. 354-61, (2013) (PubMed).

    Dai, Kolic, Marchi, Sipione, Macdonald: "SUMOylation regulates Kv2.1 and modulates pancreatic beta-cell excitability." in: Journal of cell science, Vol. 122, Issue Pt 6, pp. 775-9, (2009) (PubMed).

  • Target

    SUMO1 (Small Ubiquitin Related Modifier Protein 1 (SUMO1))

    Alternative Name

    SUMO1

    Background

    This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last four amino acids of the carboxy-terminus have been cleaved off. Several pseudogenes have been reported for this gene. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a).

    NCBI Accession

    NM_003352, NP_003343
You are here: