Mouse GNAS cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)
This is a GNAS Complex Locus plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-Entry. Insert length: 1143 bp. Transient expression. Suitable for PExp.
Bacterial selection: Kanamycin. Grade: End-sequenced.
1 image
Catalog No. ABIN3375308
Supplier Product No.: mc208566
$497.97
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 21 to 22 Business Days
Quick Overview for Mouse GNAS cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag) (ABIN3375308)
Gene
GNAS
(GNAS Complex Locus (GNAS))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-Entry
Promoter
Enhanced CMV Promoter
Bacterial Resistance
Kanamycin
Expression Type
Transient
-
-
Species
- Mouse
-
Supplier Product No.
- mc208566
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Mouse (Murine) Gnas is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: SgfI-RsrII. With the native stop codon at the end of the ORF the C-terminal Myc-DDK tag in the vector won't be expressed.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Grade
- End-sequenced
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1143 bp
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- GNAS (GNAS Complex Locus (GNAS))
-
Alternative Name
- Gnas
-
Background
- This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, which is commonly found in imprinted genes and correlates with transcript expression. This gene has an antisense transcript. One of the transcripts produced from this locus, and the antisense transcript, are both paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Additional transcript variants have been found for this gene, but the full-length nature and/or biological validity of some variants have not been determined. [provided by RefSeq, Jun 2015].Transcript Variant: This variant (8) is biallelically expressed and lacks an internal exon in the coding region, as compared to variant 7. It encodes isoform g, which lacks an internal segment and has one amino acid different, as compared to isoform h. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications. COMPLETENESS: complete on the 3' end.
-
NCBI Accession
- NM_001077510, NP_001070978
Target
-
You are here:
