Human TBC1D4 cDNA Clone in Mammalian Expression Vector
This is a TBC1 Domain Family, Member 4 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-Neo. Insert length: not_set. Transient, Stable expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
Catalog No. ABIN3376536
Supplier Product No.: sc337962
$1,703.79
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 16 to 17 Business Days
Quick Overview for Human TBC1D4 cDNA Clone in Mammalian Expression Vector (ABIN3376536)
Gene
TBC1D4
(TBC1 Domain Family, Member 4 (TBC1D4))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-Neo
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient, Stable
-
-
Species
- Human
-
Supplier Product No.
- sc337962
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human TBC1D4 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: SgfI-MluI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- TBC1D4 (TBC1 Domain Family, Member 4 (TBC1D4))
-
Alternative Name
- TBC1D4
-
Background
- This gene is a member of the Tre-2/BUB2/CDC16 domain family. The protein encoded by this gene is a Rab-GTPase-activating protein, and contains two phopshotyrosine-binding domains (PTB1 and PTB2), a calmodulin-binding domain (CBD), a Rab-GTPase domain, and multiple AKT phosphomotifs. This protein is thought to play an important role in glucose homeostasis by regulating the insulin-dependent trafficking of the glucose transporter 4 (GLUT4), important for removing glucose from the bloodstream into skeletal muscle and fat tissues. Reduced expression of this gene results in an increase in GLUT4 levels at the plasma membrane, suggesting that this protein is important in intracellular retention of GLUT4 under basal conditions. When exposed to insulin, this protein is phosphorylated, dissociates from GLUT4 vesicles, resulting in increased GLUT4 at the cell surface, and enhanced glucose transport. Phosphorylation of this protein by AKT is required for proper translocation of GLUT4 to the cell surface. Individuals homozygous for a mutation in this gene are at higher risk for type 2 diabetes and have higher levels of circulating glucose and insulin levels after glucose ingestion. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015].Transcript Variant: This variant (3) lacks two alternate in-frame exons, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.
-
NCBI Accession
- NM_001286659, NP_001273588
Target
-
You are here:
