Human ADAM17 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human ADAM17 cDNA Clone in Mammalian Expression Vector (ABIN3376549)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc316426
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ADAM17 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2500 bp
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "A disintegrin and metalloprotease 17 promotes microglial cell survival via epidermal growth factor receptor signalling following spinal cord injury." in: Molecular medicine reports, Vol. 12, Issue 1, pp. 63-70, (2015) (PubMed).
: "Liver protective effect of ursodeoxycholic acid includes regulation of ADAM17 activity." in: BMC gastroenterology, Vol. 13, pp. 155, (2014) (PubMed).
: "Glycosylation of a disintegrin and metalloprotease 17 affects its activity and inhibition." in: Analytical biochemistry, Vol. 449, pp. 68-75, (2014) (PubMed).
-
-
- ADAM17 (ADAM Metallopeptidase Domain 17 (ADAM17))
-
Alternative Name
- ADAM17
-
Background
- This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded preproprotein is proteolytically processed to generate the mature protease. The encoded protease functions in the ectodomain shedding of tumor necrosis factor-alpha, in which soluble tumor necrosis factor-alpha is released from the membrane-bound precursor. This protease also functions in the processing of numerous other substrates, including cell adhesion proteins, cytokine and growth factor receptors and epidermal growth factor (EGF) receptor ligands. The encoded protein also plays a prominent role in the activation of the Notch signaling pathway. Elevated expression of this gene has been observed in specific cell types derived from psoriasis, rheumatoid arthritis, multiple sclerosis and Crohn's disease patients, suggesting that the encoded protein may play a role in autoimmune disease. [provided by RefSeq, Feb 2016].Transcript Variant: This variant (1) contains a 50 bps insertion in 3'- coding region, as compared to variant 2. As a result of an insertion and frame shift, isoform 1 encoded by variant 1 has a cytolasmic domain containing 130 amino acids, which is absent in isoform 2 encoded by variant 2.
-
NCBI Accession
- NM_003183, NP_003174
Target
-