Human CR1 cDNA Clone in Mammalian Expression Vector
This is a Complement Component Receptor 1 (CD35) plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-Neo. Insert length: not_set. Transient, Stable expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
Catalog No. ABIN3376568
Supplier Product No.: sc300100
$2,666.07
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 71 to 72 Business Days
Quick Overview for Human CR1 cDNA Clone in Mammalian Expression Vector (ABIN3376568)
Gene
CD35 (CR1)
(Complement Component Receptor 1 (CD35) (CR1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-Neo
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient, Stable
-
-
Species
- Human
-
Supplier Product No.
- sc300100
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human CR1 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- CD35 (CR1) (Complement Component Receptor 1 (CD35) (CR1))
-
Alternative Name
- CR1
-
Background
- This gene is a member of the receptors of complement activation (RCA) family and is located in the 'cluster RCA' region of chromosome 1. The gene encodes a monomeric single-pass type I membrane glycoprotein found on erythrocytes, leukocytes, glomerular podocytes, and splenic follicular dendritic cells. The Knops blood group system is a system of antigens located on this protein. The protein mediates cellular binding to particles and immune complexes that have activated complement. Decreases in expression of this protein and/or mutations in its gene have been associated with gallbladder carcinomas, mesangiocapillary glomerulonephritis, systemic lupus erythematosus and sarcoidosis. Mutations in this gene have also been associated with a reduction in Plasmodium falciparum rosetting, conferring protection against severe malaria. Alternate allele-specific splice variants, encoding different isoforms, have been characterized. Additional allele specific isoforms, including a secreted form, have been described but have not been fully characterized. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (F, also referred to as A) is the most common transcript. It lacks several alternate exons, compared to variant S, but maintains the reading frame. The resulting protein (F, also referred to as isoform CR1-A or CR1*1) is shorter than isoform S.
-
NCBI Accession
- NM_000573, NP_000564
Target
-
You are here:
