Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human GABBR2 cDNA Clone in Mammalian Expression Vector

This is a gamma-aminobutyric Acid (GABA) B Receptor, 2 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-Neo. Insert length: 3100 bp. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3376596
Supplier Product No.: sc316628
$853.38
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 8 Business Days

Quick Overview for Human GABBR2 cDNA Clone in Mammalian Expression Vector (ABIN3376596)

Gene

GABBR2 (gamma-aminobutyric Acid (GABA) B Receptor, 2 (GABBR2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-Neo

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc316628

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human GABBR2 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3100 bp

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Huynh, Cuny, Slesinger, Adams: "Novel mechanism of voltage-gated N-type (Cav2.2) calcium channel inhibition revealed through α-conotoxin Vc1.1 activation of the GABA(B) receptor." in: Molecular pharmacology, Vol. 87, Issue 2, pp. 240-50, (2015) (PubMed).

    Yu, Seymour, Berecki, Jia, Akcan, Adams, Kaas, Craik: "Less is More: Design of a Highly Stable Disulfide-Deleted Mutant of Analgesic Cyclic α-Conotoxin Vc1.1." in: Scientific reports, Vol. 5, pp. 13264, (2015) (PubMed).

    Ariño, Höftberger, Gresa-Arribas, Martínez-Hernández, Armangue, Kruer, Arpa, Domingo, Rojc, Bataller, Saiz, Dalmau, Graus: "Paraneoplastic Neurological Syndromes and Glutamic Acid Decarboxylase Antibodies." in: JAMA neurology, Vol. 72, Issue 8, pp. 874-81, (2015) (PubMed).

  • Target

    GABBR2 (gamma-aminobutyric Acid (GABA) B Receptor, 2 (GABBR2))

    Alternative Name

    GABBR2

    Background

    The multi-pass membrane protein encoded by this gene belongs to the G-protein coupled receptor 3 family and GABA-B receptor subfamily. The GABA-B receptors inhibit neuronal activity through G protein-coupled second-messenger systems, which regulate the release of neurotransmitters, and the activity of ion channels and adenylyl cyclase. This receptor subunit forms an active heterodimeric complex with GABA-B receptor subunit 1, neither of which is effective on its own. Allelic variants of this gene have been associated with nicotine dependence.[provided by RefSeq, Jan 2010].

    NCBI Accession

    NM_005458, NP_005449
You are here: