Human KIR2DS1 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human KIR2DS1 cDNA Clone in Mammalian Expression Vector (ABIN3376625)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc304119
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human KIR2DS1 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 900 bp
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
![Human KIR2DS1 ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human KIR2DS1 ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)ORF PExp Mammalian Expression Vector pCMV6-Entry Kanamycin CMV Promoter Myc-DYKDDDDK Tag Transient
![Human KIR2DS1 ORF Clone in Mammalian Expression Vector (GFP tag)]()
Human KIR2DS1 ORF Clone in Mammalian Expression Vector (GFP tag)ORF PExp Mammalian Expression Vector pCMV6-AC-GFP Ampicillin CMV Promoter GFP tag Stable
![Human KIR2DS1 shRNA in Retroviral Vector (GFP tag)]()
Human KIR2DS1 shRNA in Retroviral Vector (GFP tag)shRNA RNAi Retroviral Vector pGFP-V-RS Kanamycin U6 Promoter GFP tag Transient
![Human KIR2DS1 shRNA in Retroviral Vector]()
Human KIR2DS1 shRNA in Retroviral VectorshRNA RNAi Retroviral Vector pRS Ampicillin U6 Promoter unconjugated Transient
![Human KIR2DS1 shRNA in Lentiviral Vector (GFP tag)]()
Human KIR2DS1 shRNA in Lentiviral Vector (GFP tag)shRNA RNAi Lentiviral Vector pGFP-C-shLenti Chloramphenicol U6 Promoter GFP tag Transient
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- KIR2DS1 (Killer Cell Immunoglobulin Like Receptor 2DS1 (KIR2DS1))
-
Alternative Name
- KIR2DS1
-
Background
- Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several 'framework' genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules, thus, KIR proteins are thought to play an important role in regulation of the immune response. [provided by RefSeq, Jul 2008].
-
NCBI Accession
- NM_014512, NP_055327
Target
-
