Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human NR1I3 cDNA Clone in Mammalian Expression Vector

This is a Nuclear Receptor Subfamily 1, Group I, Member 3 plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-Neo. Insert length: 1300 bp. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3376646
Supplier Product No.: sc315539
$754.60
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 21 to 22 Business Days

Quick Overview for Human NR1I3 cDNA Clone in Mammalian Expression Vector (ABIN3376646)

Gene

NR1I3 (Nuclear Receptor Subfamily 1, Group I, Member 3 (NR1I3))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-Neo

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc315539

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human NR1I3 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1300 bp

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Sharma, Lau, Sherman, Chang: "Differential activation of human constitutive androstane receptor and its SV23 and SV24 splice variants by rilpivirine and etravirine." in: British journal of pharmacology, Vol. 172, Issue 5, pp. 1263-76, (2015) (PubMed).

  • Target

    NR1I3 (Nuclear Receptor Subfamily 1, Group I, Member 3 (NR1I3))

    Alternative Name

    NR1I3

    Background

    This gene encodes a member of the nuclear receptor superfamily, and is a key regulator of xenobiotic and endobiotic metabolism. The protein binds to DNA as a monomer or a heterodimer with the retinoid X receptor and regulates the transcription of target genes involved in drug metabolism and bilirubin clearance, such as cytochrome P450 family members. Unlike most nuclear receptors, this transcriptional regulator is constitutively active in the absence of ligand but is regulated by both agonists and inverse agonists. Ligand binding results in translocation of this protein to the nucleus, where it activates or represses target gene transcription. These ligands include bilirubin, a variety of foreign compounds, steroid hormones, and prescription drugs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1. The resulting protein (isoform 2) is shorter than isoform 1.

    NCBI Accession

    NM_001077480, NP_001070948
You are here: