Human NR1I3 cDNA Clone in Mammalian Expression Vector
This is a Nuclear Receptor Subfamily 1, Group I, Member 3 plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-Neo. Insert length: 1300 bp. Transient, Stable expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(1 reference)
Catalog No. ABIN3376646
Supplier Product No.: sc315539
$679.14
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 21 to 22 Business Days
Quick Overview for Human NR1I3 cDNA Clone in Mammalian Expression Vector (ABIN3376646)
Gene
NR1I3
(Nuclear Receptor Subfamily 1, Group I, Member 3 (NR1I3))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-Neo
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient, Stable
-
-
Species
- Human
-
Supplier Product No.
- sc315539
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human NR1I3 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1300 bp
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Differential activation of human constitutive androstane receptor and its SV23 and SV24 splice variants by rilpivirine and etravirine." in: British journal of pharmacology, Vol. 172, Issue 5, pp. 1263-76, (2015) (PubMed).
-
-
- NR1I3 (Nuclear Receptor Subfamily 1, Group I, Member 3 (NR1I3))
-
Alternative Name
- NR1I3
-
Background
- This gene encodes a member of the nuclear receptor superfamily, and is a key regulator of xenobiotic and endobiotic metabolism. The protein binds to DNA as a monomer or a heterodimer with the retinoid X receptor and regulates the transcription of target genes involved in drug metabolism and bilirubin clearance, such as cytochrome P450 family members. Unlike most nuclear receptors, this transcriptional regulator is constitutively active in the absence of ligand but is regulated by both agonists and inverse agonists. Ligand binding results in translocation of this protein to the nucleus, where it activates or represses target gene transcription. These ligands include bilirubin, a variety of foreign compounds, steroid hormones, and prescription drugs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1. The resulting protein (isoform 2) is shorter than isoform 1.
-
NCBI Accession
- NM_001077480, NP_001070948
Target
-
You are here:
