Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human FOXM1 cDNA Clone in Mammalian Expression Vector

This is a Forkhead Box M1 plasmid from OriGene - 5 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 3460 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3376751
Supplier Product No.: sc112825
$693.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human FOXM1 cDNA Clone in Mammalian Expression Vector (ABIN3376751)

Gene

FOXM1 (Forkhead Box M1 (FOXM1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc112825

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human FOXM1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: ECoRI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3460 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Choudhary, Dodsworth, Sidders, Gutteridge, Michaelides, Duckworth, Whiting, Benn: "A FOXM1 Dependent Mesenchymal-Epithelial Transition in Retinal Pigment Epithelium Cells." in: PLoS ONE, Vol. 10, Issue 6, pp. e0130379, (2015) (PubMed).

    Liu, Gong, Sun, Li: "FOXM1 and androgen receptor co-regulate CDC6 gene transcription and DNA replication in prostate cancer cells." in: Biochimica et biophysica acta, Vol. 1839, Issue 4, pp. 297-305, (2014) (PubMed).

    Gormally, Dexheimer, Marsico, Sanders, Lowe, Matak-Vinković, Michael, Jadhav, Rai, Maloney, Simeonov, Balasubramanian: "Suppression of the FOXM1 transcriptional programme via novel small molecule inhibition." in: Nature communications, Vol. 5, pp. 5165, (2014) (PubMed).

    Bellelli, Castellone, Garcia-Rostan, Ugolini, Nucera, Sadow, Nappi, Salerno, Cantisani, Basolo, Gago, Salvatore, Santoro: "FOXM1 is a molecular determinant of the mitogenic and invasive phenotype of anaplastic thyroid carcinoma." in: Endocrine-related cancer, Vol. 19, Issue 5, pp. 695-710, (2012) (PubMed).

    Wang, Banerjee, Kong, Li, Sarkar: "Down-regulation of Forkhead Box M1 transcription factor leads to the inhibition of invasion and angiogenesis of pancreatic cancer cells." in: Cancer research, Vol. 67, Issue 17, pp. 8293-300, (2007) (PubMed).

  • Target

    FOXM1 (Forkhead Box M1 (FOXM1))

    Alternative Name

    FOXM1

    Background

    The protein encoded by this gene is a transcriptional activator involved in cell proliferation. The encoded protein is phosphorylated in M phase and regulates the expression of several cell cycle genes, such as cyclin B1 and cyclin D1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011].Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.

    NCBI Accession

    NM_021953, NP_068772
You are here: