Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human ORAI3 cDNA Clone in Mammalian Expression Vector

This is a ORAI Calcium Release-Activated Calcium Modulator 3 plasmid from OriGene - 5 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 2400 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3376788
Supplier Product No.: sc111493
$495.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human ORAI3 cDNA Clone in Mammalian Expression Vector (ABIN3376788)

Gene

ORAI3 (ORAI Calcium Release-Activated Calcium Modulator 3 (ORAI3))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc111493

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human ORAI3 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: ECoRI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2400 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Cox, Hussell, Søndergaard, Roepstorff, Bui, Deer, Zhang, Li, Lamberth, Kvist, Padkjær, Haase, Zahn, Odegard: "Antibody-mediated targeting of the Orai1 calcium channel inhibits T cell function." in: PLoS ONE, Vol. 8, Issue 12, pp. e82944, (2013) (PubMed).

    Zhang, Kozak, Jiang, Yeromin, Chen, Yu, Penna, Shen, Chi, Cahalan: "Store-dependent and -independent modes regulating Ca2+ release-activated Ca2+ channel activity of human Orai1 and Orai3." in: The Journal of biological chemistry, Vol. 283, Issue 25, pp. 17662-71, (2008) (PubMed).

    Liao, Erxleben, Yildirim, Abramowitz, Armstrong, Birnbaumer: "Orai proteins interact with TRPC channels and confer responsiveness to store depletion." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 104, Issue 11, pp. 4682-7, (2007) (PubMed).

    DeHaven, Smyth, Boyles, Putney: "Calcium inhibition and calcium potentiation of Orai1, Orai2, and Orai3 calcium release-activated calcium channels." in: The Journal of biological chemistry, Vol. 282, Issue 24, pp. 17548-56, (2007) (PubMed).

    Mercer, Dehaven, Smyth, Wedel, Boyles, Bird, Putney: "Large store-operated calcium selective currents due to co-expression of Orai1 or Orai2 with the intracellular calcium sensor, Stim1." in: The Journal of biological chemistry, Vol. 281, Issue 34, pp. 24979-90, (2006) (PubMed).

  • Target

    ORAI3 (ORAI Calcium Release-Activated Calcium Modulator 3 (ORAI3))

    Alternative Name

    ORAI3

    NCBI Accession

    NM_152288, NP_689501
You are here: