Human ADC cDNA Clone in Mammalian Expression Vector
Quick Overview for Human ADC cDNA Clone in Mammalian Expression Vector (ABIN3376920)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc108361
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ADC is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 3890 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- ADC (Arginine Decarboxylase (ADC))
-
Alternative Name
- ADC
-
Background
- The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine, however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 2, the second member of this gene family. Like antizyme inhibitor 1, antizyme inhibitor 2 interacts with all 3 antizymes and stimulates ODC activity and polyamine uptake. However, unlike antizyme inhibitor 1, which is ubiquitously expressed and localized in the nucleus and cytoplasm, antizyme inhibitor 2 is predominantly expressed in the brain and testis and localized in the endoplasmic reticulum-golgi intermediate compartment. Recent studies indicate that antizyme inhibitor 2 is also expressed in specific cell types in ovaries, adrenal glands and pancreas, and in mast cells. The exact function of this gene is not known, however, available data suggest its role in cell growth, spermiogenesis, vesicular trafficking and secretion. Accumulation of antizyme inhibitor 2 has also been observed in brains of patients with Alzheimer's disease. There has been confusion in literature and databases over the nomenclature of this gene, stemming from an earlier report that a human cDNA clone (identical to ODCp/AZIN2) had arginine decarboxylase (ADC) activity (PMID:14738999). Subsequent studies in human and mouse showed that antizyme inhibitor 2 was devoid of arginine decarboxylase activity (PMID:19956990). Alternatively spliced transcript variants have been described for this gTranscript Variant: This variant (1) represents the longest transcript and encodes the predominant isoform (1). Variants 1 and 2 encode the same isoform.
-
NCBI Accession
- NM_052998, NP_443724
Target
-