Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human ARNT2 cDNA Clone in Mammalian Expression Vector

This is a Aryl Hydrocarbon Receptor Nuclear Translocator 2 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 6930 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3377093
Supplier Product No.: sc114814
$722.70
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human ARNT2 cDNA Clone in Mammalian Expression Vector (ABIN3377093)

Gene

ARNT2 (Aryl Hydrocarbon Receptor Nuclear Translocator 2 (ARNT2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc114814

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human ARNT2 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    6930 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Zegers, Beckers, Hendrickx, Van Camp, de Craemer, Verrijken, Van Hoorenbeeck, Verhulst, Rooman, Desager, Massa, Van Gaal, Van Hul: "Mutation screen of the SIM1 gene in pediatric patients with early-onset obesity." in: International journal of obesity (2005), Vol. 38, Issue 7, pp. 1000-4, (2014) (PubMed).

    Ghoussaini, Stutzmann, Couturier, Vatin, Durand, Lecoeur, Degraeve, Heude, Tauber, Hercberg, Levy-Marchal, Tounian, Weill, Traurig, Bogardus, Baier, Michaud, Froguel, Meyre: "Analysis of the SIM1 contribution to polygenic obesity in the French population." in: Obesity (Silver Spring, Md.), Vol. 18, Issue 8, pp. 1670-5, (2010) (PubMed).

  • Target

    ARNT2 (Aryl Hydrocarbon Receptor Nuclear Translocator 2 (ARNT2))

    Alternative Name

    ARNT2

    Background

    This gene encodes a member of the basic-helix-loop-helix-Per-Arnt-Sim (bHLH-PAS) superfamily of transcription factors. The encoded protein acts as a partner for several sensor proteins of the bHLH-PAS family, forming heterodimers with the sensor proteins that bind regulatory DNA sequences in genes responsive to developmental and environmental stimuli. Under hypoxic conditions, the encoded protein complexes with hypoxia-inducible factor 1alpha in the nucleus and this complex binds to hypoxia-responsive elements in enhancers and promoters of oxygen-responsive genes. A highly similar protein in mouse forms functional complexes with both aryl hydrocarbon receptors and Single-minded proteins, suggesting additional roles for the encoded protein in the metabolism of xenobiotic compounds and the regulation of neurogenesis, respectively. [provided by RefSeq, Dec 2013].

    NCBI Accession

    NM_014862, NP_055677
You are here: