Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human B4GALT1 cDNA Clone in Mammalian Expression Vector

This is a UDP-Gal:betaGlcNAc beta 1,4 Galactosyltransferase, Polypeptide 1 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 4000 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3377159
Supplier Product No.: sc119205
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human B4GALT1 cDNA Clone in Mammalian Expression Vector (ABIN3377159)

Gene

B4GALT1 (UDP-Gal:betaGlcNAc beta 1,4 Galactosyltransferase, Polypeptide 1 (B4GALT1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc119205

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human B4GALT1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4000 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    B4GALT1 (UDP-Gal:betaGlcNAc beta 1,4 Galactosyltransferase, Polypeptide 1 (B4GALT1))

    Alternative Name

    B4GALT1

    Background

    This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose, all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene is unique among the beta4GalT genes because it encodes an enzyme that participates both in glycoconjugate and lactose biosynthesis. For the first activity, the enzyme adds galactose to N-acetylglucosamine residues that are either monosaccharides or the nonreducing ends of glycoprotein carbohydrate chains. The second activity is restricted to lactating mammary tissues where the enzyme forms a heterodimer with alpha-lactalbumin to catalyze UDP-galactose + D-glucose UDP + lactose. The two enzymatic forms result from alternate transcription initiation sites and post-translational processing. Two transcripts, which differ only at the 5' end, with approximate lengths of 4.1 kb and 3.9 kb encode the same protein. The longer transcript encodes the type II membrane-bound, trans-Golgi resident protein involved in glycoconjugate biosynthesis. The shorter transcript encodes a protein which is cleaved to form the soluble lactose synthase. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_001497, NP_001488
You are here: