Human B4GALT1 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human B4GALT1 cDNA Clone in Mammalian Expression Vector (ABIN3377159)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc119205
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human B4GALT1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 4000 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- B4GALT1 (UDP-Gal:betaGlcNAc beta 1,4 Galactosyltransferase, Polypeptide 1 (B4GALT1))
-
Alternative Name
- B4GALT1
-
Background
- This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose, all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene is unique among the beta4GalT genes because it encodes an enzyme that participates both in glycoconjugate and lactose biosynthesis. For the first activity, the enzyme adds galactose to N-acetylglucosamine residues that are either monosaccharides or the nonreducing ends of glycoprotein carbohydrate chains. The second activity is restricted to lactating mammary tissues where the enzyme forms a heterodimer with alpha-lactalbumin to catalyze UDP-galactose + D-glucose UDP + lactose. The two enzymatic forms result from alternate transcription initiation sites and post-translational processing. Two transcripts, which differ only at the 5' end, with approximate lengths of 4.1 kb and 3.9 kb encode the same protein. The longer transcript encodes the type II membrane-bound, trans-Golgi resident protein involved in glycoconjugate biosynthesis. The shorter transcript encodes a protein which is cleaved to form the soluble lactose synthase. [provided by RefSeq, Jul 2008].
-
NCBI Accession
- NM_001497, NP_001488
Target
-