Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human CASP9 cDNA Clone in Mammalian Expression Vector

This is a Caspase 9, Apoptosis-Related Cysteine Peptidase plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 3000 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3377331
Supplier Product No.: sc119362
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human CASP9 cDNA Clone in Mammalian Expression Vector (ABIN3377331)

Gene

Caspase 9 (CASP9) (Caspase 9, Apoptosis-Related Cysteine Peptidase (CASP9))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc119362

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human CASP9 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3000 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Chessari, Buck, Day, Day, Iqbal, Johnson, Lewis, Martins, Miller, Reader, Rees, Rich, Tamanini, Vitorino, Ward, Williams, Williams, Wilsher, Woolford: "Fragment-Based Drug Discovery Targeting Inhibitor of Apoptosis Proteins: Discovery of a Non-Alanine Lead Series with Dual Activity Against cIAP1 and XIAP." in: Journal of medicinal chemistry, Vol. 58, Issue 16, pp. 6574-88, (2015) (PubMed).

    Burke, Smith, Smith: "cIAP1 cooperatively inhibits procaspase-3 activation by the caspase-9 apoptosome." in: The Journal of biological chemistry, Vol. 285, Issue 39, pp. 30061-8, (2010) (PubMed).

  • Target

    Caspase 9 (CASP9) (Caspase 9, Apoptosis-Related Cysteine Peptidase (CASP9))

    Alternative Name

    CASP9

    Background

    This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein can undergo autoproteolytic processing and activation by the apoptosome, a protein complex of cytochrome c and the apoptotic peptidase activating factor 1, this step is thought to be one of the earliest in the caspase activation cascade. This protein is thought to play a central role in apoptosis and to be a tumor suppressor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013].Transcript Variant: This variant (alpha) encodes the longest isoform (alpha).

    NCBI Accession

    NM_001229, NP_001220
You are here: