Human CCR7 cDNA Clone in Mammalian Expression Vector
This is a Chemokine (C-C Motif) Receptor 7 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 2400 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(4 references)
Catalog No. ABIN3377366
Supplier Product No.: sc118981
$679.14
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human CCR7 cDNA Clone in Mammalian Expression Vector (ABIN3377366)
Gene
CCR7
(Chemokine (C-C Motif) Receptor 7 (CCR7))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL4
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc118981
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human CCR7 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2400 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Cell-free methods to produce structurally intact mammalian membrane proteins." in: Scientific reports, Vol. 6, pp. 30442, (2016) (PubMed).
: "FOXO1 regulates dendritic cell activity through ICAM-1 and CCR7." in: Journal of immunology (Baltimore, Md. : 1950), Vol. 194, Issue 8, pp. 3745-55, (2015) (PubMed).
: "Engineering lymph node homing of ex vivo-expanded human natural killer cells via trogocytosis of the chemokine receptor CCR7." in: Blood, Vol. 119, Issue 22, pp. 5164-72, (2012) (PubMed).
: "Autocrine and paracrine chemokine receptor 7 activation in head and neck cancer: implications for therapy." in: Journal of the National Cancer Institute, Vol. 100, Issue 7, pp. 502-12, (2008) (PubMed).
-
: "Cell-free methods to produce structurally intact mammalian membrane proteins." in: Scientific reports, Vol. 6, pp. 30442, (2016) (PubMed).
-
- CCR7 (Chemokine (C-C Motif) Receptor 7 (CCR7))
-
Alternative Name
- CCR7
-
Background
- The protein encoded by this gene is a member of the G protein-coupled receptor family. This receptor was identified as a gene induced by the Epstein-Barr virus (EBV), and is thought to be a mediator of EBV effects on B lymphocytes. This receptor is expressed in various lymphoid tissues and activates B and T lymphocytes. It has been shown to control the migration of memory T cells to inflamed tissues, as well as stimulate dendritic cell maturation. The chemokine (C-C motif) ligand 19 (CCL19/ECL) has been reported to be a specific ligand of this receptor. Signals mediated by this receptor regulate T cell homeostasis in lymph nodes, and may also function in the activation and polarization of T cells, and in chronic inflammation pathogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014].
-
NCBI Accession
- NM_001838, NP_001829
Target
-
You are here:
