Human CDKN1A cDNA Clone in Mammalian Expression Vector
This is a Cyclin-Dependent Kinase Inhibitor 1A (p21, Cip1) plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 2250 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(3 references)
Catalog No. ABIN3377422
Supplier Product No.: sc102496
$222.75
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human CDKN1A cDNA Clone in Mammalian Expression Vector (ABIN3377422)
Gene
p21 (CDKN1A)
(Cyclin-Dependent Kinase Inhibitor 1A (p21, Cip1) (CDKN1A))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL4
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc102496
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human CDKN1A is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2250 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "The effects of two polymorphisms on p21cip1 function and their association with Alzheimer's disease in a population of European descent." in: PLoS ONE, Vol. 10, Issue 1, pp. e0114050, (2015) (PubMed).
: "Depletion of the poly(C)-binding proteins alphaCP1 and alphaCP2 from K562 cells leads to p53-independent induction of cyclin-dependent kinase inhibitor (CDKN1A) and G1 arrest." in: The Journal of biological chemistry, Vol. 284, Issue 14, pp. 9039-49, (2009) (PubMed).
: "The Aurora kinase inhibitor VX-680 induces endoreduplication and apoptosis preferentially in cells with compromised p53-dependent postmitotic checkpoint function." in: Cancer research, Vol. 66, Issue 15, pp. 7668-77, (2006) (PubMed).
-
-
- p21 (CDKN1A) (Cyclin-Dependent Kinase Inhibitor 1A (p21, Cip1) (CDKN1A))
-
Alternative Name
- CDKN1A
-
Background
- This gene encodes a potent cyclin-dependent kinase inhibitor. The encoded protein binds to and inhibits the activity of cyclin-cyclin-dependent kinase2 or -cyclin-dependent kinase4 complexes, and thus functions as a regulator of cell cycle progression at G1. The expression of this gene is tightly controlled by the tumor suppressor protein p53, through which this protein mediates the p53-dependent cell cycle G1 phase arrest in response to a variety of stress stimuli. This protein can interact with proliferating cell nuclear antigen, a DNA polymerase accessory factor, and plays a regulatory role in S phase DNA replication and DNA damage repair. This protein was reported to be specifically cleaved by CASP3-like caspases, which thus leads to a dramatic activation of cyclin-dependent kinase2, and may be instrumental in the execution of apoptosis following caspase activation. Mice that lack this gene have the ability to regenerate damaged or missing tissue. Multiple alternatively spliced variants have been found for this gene. [provided by RefSeq, Sep 2015].Transcript Variant: This variant (2) differs in the 5' UTR, lacks an in-frame portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 3. The resulting isoform (1) has a shorter N-terminus, compared to isoform 2. Variants 1, 2, 4 and 5 encode the same isoform 1.
-
NCBI Accession
- NM_078467, NP_510867
Target
-
You are here:
