Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human CNR1 cDNA Clone in Mammalian Expression Vector

This is a Cannabinoid Receptor 1 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 5700 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3377519
Supplier Product No.: sc111611
$679.14
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human CNR1 cDNA Clone in Mammalian Expression Vector (ABIN3377519)

Gene

CNR1 (Cannabinoid Receptor 1 (CNR1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc111611

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human CNR1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    5700 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Bruno, Lembo, Novellino, Stornaiuolo, Marinelli: "Beyond radio-displacement techniques for identification of CB1 ligands: the first application of a fluorescence-quenching assay." in: Scientific reports, Vol. 4, pp. 3757, (2014) (PubMed).

    Tarawneh, León, Ibrahim, Pettaway, McCurdy, Cutler: "Flavanones from Miconia prasina." in: Phytochemistry letters, Vol. 7, pp. 130-132, (2014) (PubMed).

    Son, Kim, Chae, Kim, Shin, Ahn, Choi, Yang, Park, Chae, Moon, Kim, Shin, Yoon: "Peripherally acting CB1-receptor antagonist: the relative importance of central and peripheral CB1 receptors in adiposity control." in: International journal of obesity (2005), Vol. 34, Issue 3, pp. 547-56, (2010) (PubMed).

  • Target

    CNR1 (Cannabinoid Receptor 1 (CNR1))

    Alternative Name

    CNR1

    Background

    This gene encodes one of two cannabinoid receptors. The cannabinoids, principally delta-9-tetrahydrocannabinol and synthetic analogs, are psychoactive ingredients of marijuana. The cannabinoid receptors are members of the guanine-nucleotide-binding protein (G-protein) coupled receptor family, which inhibit adenylate cyclase activity in a dose-dependent, stereoselective and pertussis toxin-sensitive manner. The two receptors have been found to be involved in the cannabinoid-induced CNS effects (including alterations in mood and cognition) experienced by users of marijuana. Multiple transcript variants encoding two different protein isoforms have been described for this gene. [provided by RefSeq, May 2009].Transcript Variant: This variant (1) encodes the longer isoform (a). Variant 1 has also been called CB1A by PubMed ID: 15289816. Variants 1, 3, 4 and 5 all encode isoform a.

    NCBI Accession

    NM_016083, NP_057167
You are here: