Human CYP19A1 cDNA Clone in Mammalian Expression Vector
This is a Cytochrome P450, Family 19, Subfamily A, Polypeptide 1 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 3050 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(3 references)
Catalog No. ABIN3377644
Supplier Product No.: sc127848
$464.31
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human CYP19A1 cDNA Clone in Mammalian Expression Vector (ABIN3377644)
Gene
Aromatase (CYP19A1)
(Cytochrome P450, Family 19, Subfamily A, Polypeptide 1 (CYP19A1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL4
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc127848
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human CYP19A1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 3050 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Effect of sildenafil on human aromatase activity: From in vitro structural analysis to catalysis and inhibition in cells." in: The Journal of steroid biochemistry and molecular biology, Vol. 165, Issue Pt B, pp. 438-447, (2016) (PubMed).
: "A common polymorphism in the human aromatase gene alters the risk for polycystic ovary syndrome and modifies aromatase activity in vitro." in: Molecular human reproduction, Vol. 17, Issue 6, pp. 386-91, (2011) (PubMed).
: "Expression of the K303R estrogen receptor-alpha breast cancer mutation induces resistance to an aromatase inhibitor via addiction to the PI3K/Akt kinase pathway." in: Cancer research, Vol. 69, Issue 11, pp. 4724-32, (2009) (PubMed).
-
-
- Aromatase (CYP19A1) (Cytochrome P450, Family 19, Subfamily A, Polypeptide 1 (CYP19A1))
-
Alternative Name
- CYP19A1
-
Background
- This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and catalyzes the last steps of estrogen biosynthesis. Mutations in this gene can result in either increased or decreased aromatase activity, the associated phenotypes suggest that estrogen functions both as a sex steroid hormone and in growth or differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014].Transcript Variant: This variant (1) does not include exon 2a, and thus has a shorter 5' UTR than transcript variant 2. Both variants encode the same protein.
-
NCBI Accession
- NM_000103, NP_000094
Target
-
You are here:
