Human CYP3A4 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human CYP3A4 cDNA Clone in Mammalian Expression Vector (ABIN3377659)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc125488
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human CYP3A4 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2150 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Transport and uptake of clausenamide enantiomers in CYP3A4-transfected Caco-2 cells: An insight into the efflux-metabolism alliance." in: Biochemical pharmacology, Vol. 98, Issue 1, pp. 224-30, (2015) (PubMed).
: "Cytochrome P450 3A5 plays a prominent role in the oxidative metabolism of the anti-human immunodeficiency virus drug maraviroc." in: Drug metabolism and disposition: the biological fate of chemicals, Vol. 40, Issue 12, pp. 2221-30, (2012) (PubMed).
-
-
- CYP3A4 (Cytochrome P450, Family 3, Subfamily A, Polypeptide 4 (CYP3A4))
-
Alternative Name
- CYP3A4
-
Background
- This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases that catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by glucocorticoids and some pharmacological agents. This enzyme is involved in the metabolism of approximately half the drugs in use today, including acetaminophen, codeine, cyclosporin A, diazepam and erythromycin. The enzyme also metabolizes some steroids and carcinogens. This gene is part of a cluster of cytochrome P450 genes on chromosome 7q21.1. Previously another CYP3A gene, CYP3A3, was thought to exist, however, it is now thought that this sequence represents a transcript variant of CYP3A4. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Feb 2011].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
-
NCBI Accession
- NM_017460, NP_059488
Target
-