Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human CYP3A4 cDNA Clone in Mammalian Expression Vector

This is a Cytochrome P450, Family 3, Subfamily A, Polypeptide 4 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 2150 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3377659
Supplier Product No.: sc125488
$774.40
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human CYP3A4 cDNA Clone in Mammalian Expression Vector (ABIN3377659)

Gene

CYP3A4 (Cytochrome P450, Family 3, Subfamily A, Polypeptide 4 (CYP3A4))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc125488

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human CYP3A4 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2150 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Hua, Shi, Zhu, Li, Wang, Yu, Li, Zhu: "Transport and uptake of clausenamide enantiomers in CYP3A4-transfected Caco-2 cells: An insight into the efflux-metabolism alliance." in: Biochemical pharmacology, Vol. 98, Issue 1, pp. 224-30, (2015) (PubMed).

    Lu, Hendrix, Bumpus: "Cytochrome P450 3A5 plays a prominent role in the oxidative metabolism of the anti-human immunodeficiency virus drug maraviroc." in: Drug metabolism and disposition: the biological fate of chemicals, Vol. 40, Issue 12, pp. 2221-30, (2012) (PubMed).

  • Target

    CYP3A4 (Cytochrome P450, Family 3, Subfamily A, Polypeptide 4 (CYP3A4))

    Alternative Name

    CYP3A4

    Background

    This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases that catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by glucocorticoids and some pharmacological agents. This enzyme is involved in the metabolism of approximately half the drugs in use today, including acetaminophen, codeine, cyclosporin A, diazepam and erythromycin. The enzyme also metabolizes some steroids and carcinogens. This gene is part of a cluster of cytochrome P450 genes on chromosome 7q21.1. Previously another CYP3A gene, CYP3A3, was thought to exist, however, it is now thought that this sequence represents a transcript variant of CYP3A4. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Feb 2011].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

    NCBI Accession

    NM_017460, NP_059488
You are here: