Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human DFFB cDNA Clone in Mammalian Expression Vector

This is a DNA Fragmentation Factor, 40kDa, beta Polypeptide (Caspase-Activated DNase) plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 3340 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3377730
Supplier Product No.: sc107911
$502.70
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human DFFB cDNA Clone in Mammalian Expression Vector (ABIN3377730)

Gene

DFFB (DNA Fragmentation Factor, 40kDa, beta Polypeptide (Caspase-Activated DNase) (DFFB))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc107911

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human DFFB is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3340 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Yoon, Park, Han, Kang, Kim, Lee, Park, Shin, Kim, Yun, Chwae: "Caspase-dependent cell death-associated release of nucleosome and damage-associated molecular patterns." in: Cell death & disease, Vol. 5, pp. e1494, (2014) (PubMed).

  • Target

    DFFB (DNA Fragmentation Factor, 40kDa, beta Polypeptide (Caspase-Activated DNase) (DFFB))

    Alternative Name

    DFFB

    Background

    Apoptosis is a cell death process that removes toxic and/or useless cells during mammalian development. The apoptotic process is accompanied by shrinkage and fragmentation of the cells and nuclei and degradation of the chromosomal DNA into nucleosomal units. DNA fragmentation factor (DFF) is a heterodimeric protein of 40-kD (DFFB) and 45-kD (DFFA) subunits. DFFA is the substrate for caspase-3 and triggers DNA fragmentation during apoptosis. DFF becomes activated when DFFA is cleaved by caspase-3. The cleaved fragments of DFFA dissociate from DFFB, the active component of DFF. DFFB has been found to trigger both DNA fragmentation and chromatin condensation during apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of some of these variants has not been determined. [provided by RefSeq, Sep 2013].Transcript Variant: This variant (2) contains two consecutive alternate splice junctions compared to variant 1. The resulting isoform (2) has the same N- and C-termini but lacks an internal segment compared to isoform 1.

    NCBI Accession

    NM_004402, NP_004393
You are here: