Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human EFNB2 cDNA Clone in Mammalian Expression Vector

This is a Ephrin B2 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 4700 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3377850
Supplier Product No.: sc117586
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human EFNB2 cDNA Clone in Mammalian Expression Vector (ABIN3377850)

Gene

Ephrin B2 (EFNB2)

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc117586

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human EFNB2 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4700 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Caporali, Meloni, Nailor, Mitić, Shantikumar, Riu, Sala-Newby, Rose, Besnier, Katare, Voellenkle, Verkade, Martelli, Madeddu, Emanueli: "p75(NTR)-dependent activation of NF-κB regulates microRNA-503 transcription and pericyte-endothelial crosstalk in diabetes after limb ischaemia." in: Nature communications, Vol. 6, pp. 8024, (2015) (PubMed).

    Bishop, Stantchev, Hickey, Khetawat, Bossart, Krasnoperov, Gill, Feng, Wang, Eaton, Wang, Broder: "Identification of Hendra virus G glycoprotein residues that are critical for receptor binding." in: Journal of virology, Vol. 81, Issue 11, pp. 5893-901, (2007) (PubMed).

    Guillaume, Aslan, Ainouze, Guerbois, Wild, Buckland, Langedijk et al.: "Evidence of a potential receptor-binding site on the Nipah virus G protein (NiV-G): identification of globular head residues with a role in fusion promotion and their localization on an NiV-G ..." in: Journal of virology, Vol. 80, Issue 15, pp. 7546-54, (2006) (PubMed).

    Bonaparte, Dimitrov, Bossart, Crameri, Mungall, Bishop, Choudhry, Dimitrov, Wang, Eaton, Broder: "Ephrin-B2 ligand is a functional receptor for Hendra virus and Nipah virus." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 102, Issue 30, pp. 10652-7, (2005) (PubMed).

  • Target

    Ephrin B2 (EFNB2)

    Alternative Name

    EFNB2

    Background

    This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNB class ephrin which binds to the EPHB4 and EPHA3 receptors. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_004093, NP_004084
You are here: