Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human ELK1 cDNA Clone in Mammalian Expression Vector

This is a ELK1, Member of ETS Oncogene Family plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 2800 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3377880
Supplier Product No.: sc116858
$679.14
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human ELK1 cDNA Clone in Mammalian Expression Vector (ABIN3377880)

Gene

ELK1 (ELK1, Member of ETS Oncogene Family (ELK1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc116858

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human ELK1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2800 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Patki, Chari, Sivakumaran, Gonit, Trumbly, Ratnam: "The ETS domain transcription factor ELK1 directs a critical component of growth signaling by the androgen receptor in prostate cancer cells." in: The Journal of biological chemistry, Vol. 288, Issue 16, pp. 11047-65, (2013) (PubMed).

    Zhang, Zhang, Gao, Wang, Liu: "Regulation of the microRNA 200b (miRNA-200b) by transcriptional regulators PEA3 and ELK-1 protein affects expression of Pin1 protein to control anoikis." in: The Journal of biological chemistry, Vol. 288, Issue 45, pp. 32742-52, (2013) (PubMed).

    Reichman, Kalathur, Lambard, Aït-Ali, Yang, Lardenois, Ripp, Poch, Zack, Sahel, Léveillard: "The homeobox gene CHX10/VSX2 regulates RdCVF promoter activity in the inner retina." in: Human molecular genetics, Vol. 19, Issue 2, pp. 250-61, (2009) (PubMed).

    Aprelikova, Wood, Tackett, Chandramouli, Barrett: "Role of ETS transcription factors in the hypoxia-inducible factor-2 target gene selection." in: Cancer research, Vol. 66, Issue 11, pp. 5641-7, (2006) (PubMed).

  • Target

    ELK1 (ELK1, Member of ETS Oncogene Family (ELK1))

    Alternative Name

    ELK1

    Background

    This gene is a member of the Ets family of transcription factors and of the ternary complex factor (TCF) subfamily. Proteins of the TCF subfamily form a ternary complex by binding to the the serum response factor and the serum response element in the promoter of the c-fos proto-oncogene. The protein encoded by this gene is a nuclear target for the ras-raf-MAPK signaling cascade. This gene produces multiple isoforms by using alternative translational start codons and by alternative splicing. Related pseudogenes have been identified on chromosomes 7 and 14. [provided by RefSeq, Mar 2012].Transcript Variant: This variant (2, also known as 5'UTR short or 5'UTRS) lacks an alternate exon in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode isoform a. Delayed translational reinitiation from an alternative downstream start codon, AUG sElk-1, can also result in a shorter isoform (sELK-1), as described in PMID:22354998.

    NCBI Accession

    NM_005229, NP_005220
You are here: