Human ELK1 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human ELK1 cDNA Clone in Mammalian Expression Vector (ABIN3377880)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc116858
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ELK1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2800 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "The ETS domain transcription factor ELK1 directs a critical component of growth signaling by the androgen receptor in prostate cancer cells." in: The Journal of biological chemistry, Vol. 288, Issue 16, pp. 11047-65, (2013) (PubMed).
: "Regulation of the microRNA 200b (miRNA-200b) by transcriptional regulators PEA3 and ELK-1 protein affects expression of Pin1 protein to control anoikis." in: The Journal of biological chemistry, Vol. 288, Issue 45, pp. 32742-52, (2013) (PubMed).
: "The homeobox gene CHX10/VSX2 regulates RdCVF promoter activity in the inner retina." in: Human molecular genetics, Vol. 19, Issue 2, pp. 250-61, (2009) (PubMed).
: "Role of ETS transcription factors in the hypoxia-inducible factor-2 target gene selection." in: Cancer research, Vol. 66, Issue 11, pp. 5641-7, (2006) (PubMed).
-
-
- ELK1 (ELK1, Member of ETS Oncogene Family (ELK1))
-
Alternative Name
- ELK1
-
Background
- This gene is a member of the Ets family of transcription factors and of the ternary complex factor (TCF) subfamily. Proteins of the TCF subfamily form a ternary complex by binding to the the serum response factor and the serum response element in the promoter of the c-fos proto-oncogene. The protein encoded by this gene is a nuclear target for the ras-raf-MAPK signaling cascade. This gene produces multiple isoforms by using alternative translational start codons and by alternative splicing. Related pseudogenes have been identified on chromosomes 7 and 14. [provided by RefSeq, Mar 2012].Transcript Variant: This variant (2, also known as 5'UTR short or 5'UTRS) lacks an alternate exon in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode isoform a. Delayed translational reinitiation from an alternative downstream start codon, AUG sElk-1, can also result in a shorter isoform (sELK-1), as described in PMID:22354998.
-
NCBI Accession
- NM_005229, NP_005220
Target
-