Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human FZD6 cDNA Clone in Mammalian Expression Vector

This is a Frizzled Family Receptor 6 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: not_set. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3378125
Supplier Product No.: sc316995
$640.53
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human FZD6 cDNA Clone in Mammalian Expression Vector (ABIN3378125)

Gene

FZD6 (Frizzled Family Receptor 6 (FZD6))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc316995

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human FZD6 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Kawano, Diez, Uysal-Onganer, Darrington, Waxman, Kypta: "Secreted Frizzled-related protein-1 is a negative regulator of androgen receptor activity in prostate cancer." in: British journal of cancer, Vol. 100, Issue 7, pp. 1165-74, (2009) (PubMed).

    Binnerts, Kim, Bright, Patel, Tran, Zhou, Leung, Liu, Lomas, Dixon, Hazell, Wagle, Nie, Tomasevic, Williams, Zhan, Levy, Funk, Abo: "R-Spondin1 regulates Wnt signaling by inhibiting internalization of LRP6." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 104, Issue 37, pp. 14700-5, (2007) (PubMed).

  • Target

    FZD6 (Frizzled Family Receptor 6 (FZD6))

    Alternative Name

    FZD6

    Background

    This gene represents a member of the 'frizzled' gene family, which encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The protein encoded by this family member contains a signal peptide, a cysteine-rich domain in the N-terminal extracellular region, and seven transmembrane domains, but unlike other family members, this protein does not contain a C-terminal PDZ domain-binding motif. This protein functions as a negative regulator of the canonical Wnt/beta-catenin signaling cascade, thereby inhibiting the processes that trigger oncogenic transformation, cell proliferation, and inhibition of apoptosis. Alternative splicing results in multiple transcript variants, some of which do not encode a protein with a predicted signal peptide.[provided by RefSeq, Aug 2011].Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Both variants 1 and 2 encode the same isoform.

    NCBI Accession

    NM_003506, NP_003497
You are here: