Human HLA cDNA Clone in Mammalian Expression Vector
Quick Overview for Human HLA cDNA Clone in Mammalian Expression Vector (ABIN3378365)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc118796
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human HLA is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1180 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
![Human HLA ORF Clone in Lenti Particles (GFP tag)]()
Human HLA ORF Clone in Lenti Particles (GFP tag)ORF PExp Lentiviral Vector pLenti-C-mGFP Chloramphenicol CMV Promoter GFP tag Transient
![Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)]()
Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
![Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)]()
Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
![Human HLA ORF Clone in Lenti Particles (GFP tag)]()
Human HLA ORF Clone in Lenti Particles (GFP tag)ORF PExp Lentiviral Vector pLenti-C-mGFP Chloramphenicol CMV Promoter GFP tag Transient
![Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)]()
Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
![Human HLA ORF Clone in Lenti Particles (GFP tag)]()
Human HLA ORF Clone in Lenti Particles (GFP tag)ORF PExp Lentiviral Vector pLenti-C-mGFP Chloramphenicol CMV Promoter GFP tag Transient
![Human HLA ORF Clone in Lenti Particles (GFP tag)]()
Human HLA ORF Clone in Lenti Particles (GFP tag)ORF PExp Lentiviral Vector pLenti-C-mGFP Chloramphenicol CMV Promoter GFP tag Transient
![Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)]()
Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
![Human HLA ORF Clone in Lenti Particles (GFP tag)]()
Human HLA ORF Clone in Lenti Particles (GFP tag)ORF PExp Lentiviral Vector pLenti-C-mGFP Chloramphenicol CMV Promoter GFP tag Transient
![Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)]()
Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- HLA
-
Background
- HLA-DQB1 belongs to the HLA class II beta chain paralogs. This class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and it contains six exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011].Transcript Variant: This variant (1) is the predominant transcript and encodes isoform 1. This transcript represents the DQB1*06:02:01:01 allele of the HLA-DQB1 gene, as represented in the assembled chromosome 6 in the primary assembly of the reference genome.
-
NCBI Accession
- NM_002123, NP_002114
Target
-
