Human HLA cDNA Clone in Mammalian Expression Vector
Quick Overview for Human HLA cDNA Clone in Mammalian Expression Vector (ABIN3378366)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc128256
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human HLA is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1200 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
![Human HLA ORF Clone in Lenti Particles (GFP tag)]()
Human HLA ORF Clone in Lenti Particles (GFP tag)ORF PExp Lentiviral Vector pLenti-C-mGFP Chloramphenicol CMV Promoter GFP tag Transient
![Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)]()
Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
![Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)]()
Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
![Human HLA ORF Clone in Lenti Particles (GFP tag)]()
Human HLA ORF Clone in Lenti Particles (GFP tag)ORF PExp Lentiviral Vector pLenti-C-mGFP Chloramphenicol CMV Promoter GFP tag Transient
![Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)]()
Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
![Human HLA ORF Clone in Lenti Particles (GFP tag)]()
Human HLA ORF Clone in Lenti Particles (GFP tag)ORF PExp Lentiviral Vector pLenti-C-mGFP Chloramphenicol CMV Promoter GFP tag Transient
![Human HLA ORF Clone in Lenti Particles (GFP tag)]()
Human HLA ORF Clone in Lenti Particles (GFP tag)ORF PExp Lentiviral Vector pLenti-C-mGFP Chloramphenicol CMV Promoter GFP tag Transient
![Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)]()
Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
![Human HLA ORF Clone in Lenti Particles (GFP tag)]()
Human HLA ORF Clone in Lenti Particles (GFP tag)ORF PExp Lentiviral Vector pLenti-C-mGFP Chloramphenicol CMV Promoter GFP tag Transient
![Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)]()
Human HLA ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- HLA
-
Background
- HLA-DRB5 belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DRA) and a beta (DRB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. DRB1 is expressed at a level five times higher than its paralogues DRB3, DRB4 and DRB5. The presence of DRB5 is linked with allelic variants of DRB1, otherwise it is omitted. There are 4 related pseudogenes: DRB2, DRB6, DRB7, DRB8 and DRB9. [provided by RefSeq, Jul 2008].
-
NCBI Accession
- NM_002125, NP_002116
Target
-
