Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human HP cDNA Clone in Mammalian Expression Vector

This is a Haptoglobin plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 1450 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3378387
Supplier Product No.: sc116954
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human HP cDNA Clone in Mammalian Expression Vector (ABIN3378387)

Gene

Haptoglobin (HP)

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc116954

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human HP is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1450 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Tripathi, Lammers, Goldblum, Shea-Donohue, Netzel-Arnett, Buzza, Antalis, Vogel, Zhao, Yang, Arrietta, Meddings, Fasano: "Identification of human zonulin, a physiological modulator of tight junctions, as prehaptoglobin-2." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 106, Issue 39, pp. 16799-804, (2009) (PubMed).

  • Target

    Haptoglobin (HP)

    Alternative Name

    HP

    Background

    This gene encodes a preproprotein, which is processed to yield both alpha and beta chains, which subsequently combine as a tetramer to produce haptoglobin. Haptoglobin functions to bind free plasma hemoglobin, which allows degradative enzymes to gain access to the hemoglobin, while at the same time preventing loss of iron through the kidneys and protecting the kidneys from damage by hemoglobin. Mutations in this gene and/or its regulatory regions cause ahaptoglobinemia or hypohaptoglobinemia. This gene has also been linked to diabetic nephropathy, the incidence of coronary artery disease in type 1 diabetes, Crohn's disease, inflammatory disease behavior, primary sclerosing cholangitis, susceptibility to idiopathic Parkinson's disease, and a reduced incidence of Plasmodium falciparum malaria. The protein encoded also exhibits antimicrobial activity against bacteria. A similar duplicated gene is located next to this gene on chromosome 16. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2014].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

    NCBI Accession

    NM_005143, NP_005134
You are here:
Blank Blank Blank Blank
Blank Blank Blank Blank