Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human IGFBP7 cDNA Clone in Mammalian Expression Vector

This is a Insulin-Like Growth Factor Binding Protein 7 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 1200 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3378439
Supplier Product No.: sc119176
$445.50
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human IGFBP7 cDNA Clone in Mammalian Expression Vector (ABIN3378439)

Gene

IGFBP7 (Insulin-Like Growth Factor Binding Protein 7 (IGFBP7))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc119176

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human IGFBP7 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1200 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Verhagen, de Leeuw, Roemer, Denkers, Pouwels, Rutten, Celie, Ossenkoppele, Schuurhuis, Smit: "IGFBP7 induces apoptosis of acute myeloid leukemia cells and synergizes with chemotherapy in suppression of leukemia cell survival." in: Cell death & disease, Vol. 5, pp. e1300, (2014) (PubMed).

    Chen, Yoo, Santhekadur, Gredler, Bhutia, Das, Fuller, Su, Fisher, Sarkar: "Insulin-like growth factor-binding protein-7 functions as a potential tumor suppressor in hepatocellular carcinoma." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 17, Issue 21, pp. 6693-701, (2011) (PubMed).

    Tomimaru, Eguchi, Wada, Noda, Murakami, Kobayashi, Marubashi, Takeda, Tanemura, Umeshita, Doki, Mori, Nagano: "Insulin-like growth factor-binding protein 7 alters the sensitivity to interferon-based anticancer therapy in hepatocellular carcinoma cells." in: British journal of cancer, Vol. 102, Issue 10, pp. 1483-90, (2010) (PubMed).

  • Target

    IGFBP7 (Insulin-Like Growth Factor Binding Protein 7 (IGFBP7))

    Alternative Name

    IGFBP7

    Background

    This gene encodes a member of the insulin-like growth factor (IGF)-binding protein (IGFBP) family. IGFBPs bind IGFs with high affinity, and regulate IGF availability in body fluids and tissues and modulate IGF binding to its receptors. This protein binds IGF-I and IGF-II with relatively low affinity, and belongs to a subfamily of low-affinity IGFBPs. It also stimulates prostacyclin production and cell adhesion. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, and one variant has been associated with retinal arterial macroaneurysm (PMID:21835307). [provided by RefSeq, Dec 2011].Transcript Variant: This variant (1) represents the predominant transcript, and encodes the longer isoform (1).

    NCBI Accession

    NM_001553, NP_001544
You are here: