Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human JUN cDNA Clone in Mammalian Expression Vector

This is a Jun Proto-Oncogene plasmid from OriGene - 5 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 2080 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3378516
Supplier Product No.: sc118762
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human JUN cDNA Clone in Mammalian Expression Vector (ABIN3378516)

Gene

C-JUN (JUN) (Jun Proto-Oncogene (JUN))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc118762

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human JUN is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2080 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Li, Yan, Zhang, Hu, Chen, Wang, Kang, Ou: "Suppression of endothelial nitric oxide synthase expression and endothelial cell proliferation by an intronic 27-ntmiRNA and it's a novel link to AP-1." in: American journal of translational research, Vol. 7, Issue 2, pp. 285-97, (2015) (PubMed).

    Zhang, Zhao, Li, Li, Cai, Shen, Shi, Li, Liu, Zhang, Ye: "The nuclear import of oncoprotein hepatitis B X-interacting protein depends on interacting with c-Fos and phosphorylation of both proteins in breast cancer cells." in: The Journal of biological chemistry, Vol. 288, Issue 26, pp. 18961-74, (2013) (PubMed).

    Lajoie, Lewkowich, Suzuki, Clark, Sproles, Dienger, Budelsky, Wills-Karp: "Complement-mediated regulation of the IL-17A axis is a central genetic determinant of the severity of experimental allergic asthma." in: Nature immunology, Vol. 11, Issue 10, pp. 928-35, (2010) (PubMed).

    Bein, Wesselkamper, Liu, Dietsch, Majumder, Concel, Medvedovic, Sartor, Henning, Venditto, Borchers, Barchowsky, Weaver, Tichelaar, Prows, Korfhagen, Hardie, Bachurski, Leikauf: "Surfactant-associated protein B is critical to survival in nickel-induced injury in mice." in: American journal of respiratory cell and molecular biology, Vol. 41, Issue 2, pp. 226-36, (2009) (PubMed).

    Goruppi, Patten, Force, Kyriakis: "Helix-loop-helix protein p8, a transcriptional regulator required for cardiomyocyte hypertrophy and cardiac fibroblast matrix metalloprotease induction." in: Molecular and cellular biology, Vol. 27, Issue 3, pp. 993-1006, (2007) (PubMed).

  • Target

    C-JUN (JUN) (Jun Proto-Oncogene (JUN))

    Alternative Name

    JUN

    Background

    This gene is the putative transforming gene of avian sarcoma virus 17. It encodes a protein which is highly similar to the viral protein, and which interacts directly with specific target DNA sequences to regulate gene expression. This gene is intronless and is mapped to 1p32-p31, a chromosomal region involved in both translocations and deletions in human malignancies. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_002228, NP_002219
You are here: