Human JUN cDNA Clone in Mammalian Expression Vector
Quick Overview for Human JUN cDNA Clone in Mammalian Expression Vector (ABIN3378516)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc118762
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human JUN is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2080 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Suppression of endothelial nitric oxide synthase expression and endothelial cell proliferation by an intronic 27-ntmiRNA and it's a novel link to AP-1." in: American journal of translational research, Vol. 7, Issue 2, pp. 285-97, (2015) (PubMed).
: "The nuclear import of oncoprotein hepatitis B X-interacting protein depends on interacting with c-Fos and phosphorylation of both proteins in breast cancer cells." in: The Journal of biological chemistry, Vol. 288, Issue 26, pp. 18961-74, (2013) (PubMed).
: "Complement-mediated regulation of the IL-17A axis is a central genetic determinant of the severity of experimental allergic asthma." in: Nature immunology, Vol. 11, Issue 10, pp. 928-35, (2010) (PubMed).
: "Surfactant-associated protein B is critical to survival in nickel-induced injury in mice." in: American journal of respiratory cell and molecular biology, Vol. 41, Issue 2, pp. 226-36, (2009) (PubMed).
: "Helix-loop-helix protein p8, a transcriptional regulator required for cardiomyocyte hypertrophy and cardiac fibroblast matrix metalloprotease induction." in: Molecular and cellular biology, Vol. 27, Issue 3, pp. 993-1006, (2007) (PubMed).
-
: "Suppression of endothelial nitric oxide synthase expression and endothelial cell proliferation by an intronic 27-ntmiRNA and it's a novel link to AP-1." in: American journal of translational research, Vol. 7, Issue 2, pp. 285-97, (2015) (PubMed).
-
- C-JUN (JUN) (Jun Proto-Oncogene (JUN))
-
Alternative Name
- JUN
-
Background
- This gene is the putative transforming gene of avian sarcoma virus 17. It encodes a protein which is highly similar to the viral protein, and which interacts directly with specific target DNA sequences to regulate gene expression. This gene is intronless and is mapped to 1p32-p31, a chromosomal region involved in both translocations and deletions in human malignancies. [provided by RefSeq, Jul 2008].
-
NCBI Accession
- NM_002228, NP_002219
Target
-