Human LAMC1 cDNA Clone in Mammalian Expression Vector
This is a Laminin, gamma 1 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 7440 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
Catalog No. ABIN3378642
Supplier Product No.: sc118737
$1,363.23
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human LAMC1 cDNA Clone in Mammalian Expression Vector (ABIN3378642)
Gene
Laminin gamma 1 (LAMC1)
(Laminin, gamma 1 (LAMC1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL4
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc118737
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human LAMC1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 7440 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- Laminin gamma 1 (LAMC1) (Laminin, gamma 1 (LAMC1))
-
Alternative Name
- LAMC1
-
Background
- Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011].
-
NCBI Accession
- NM_002293, NP_002284
Target
-
You are here:
