Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human LPIN1 cDNA Clone in Mammalian Expression Vector

This is a Lipin 1 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 4230 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3378728
Supplier Product No.: sc125492
$807.84
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 31 to 32 Business Days

Quick Overview for Human LPIN1 cDNA Clone in Mammalian Expression Vector (ABIN3378728)

Gene

Lipin 1 (LPIN1)

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc125492

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human LPIN1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4230 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Valdearcos, Esquinas, Meana, Gil-de-Gómez, Guijas, Balsinde, Balboa: "Subcellular localization and role of lipin-1 in human macrophages." in: Journal of immunology (Baltimore, Md. : 1950), Vol. 186, Issue 10, pp. 6004-13, (2011) (PubMed).

    Han, Carman: "Characterization of the human LPIN1-encoded phosphatidate phosphatase isoforms." in: The Journal of biological chemistry, Vol. 285, Issue 19, pp. 14628-38, (2010) (PubMed).

    Han, Wu, Carman: "The Saccharomyces cerevisiae Lipin homolog is a Mg2+-dependent phosphatidate phosphatase enzyme." in: The Journal of biological chemistry, Vol. 281, Issue 14, pp. 9210-8, (2006) (PubMed).

  • Target

    Lipin 1 (LPIN1)

    Alternative Name

    LPIN1

    Background

    This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their full-length structures have not been determined. [provided by RefSeq, May 2012].Transcript Variant: This variant (1) encodes the 890 aa isoform (1, also known as alpha) that was described earliest in published descriptions of this human gene.

    NCBI Accession

    NM_145693, NP_663731
You are here: