Human MAPK8 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human MAPK8 cDNA Clone in Mammalian Expression Vector (ABIN3378822)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc124375
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human MAPK8 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 5000 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- JNK (MAPK8) (Mitogen-Activated Protein Kinase 8 (MAPK8))
-
Alternative Name
- MAPK8
-
Background
- The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various cell stimuli, and targets specific transcription factors, and thus mediates immediate-early gene expression in response to cell stimuli. The activation of this kinase by tumor-necrosis factor alpha (TNF-alpha) is found to be required for TNF-alpha induced apoptosis. This kinase is also involved in UV radiation induced apoptosis, which is thought to be related to cytochrom c-mediated cell death pathway. Studies of the mouse counterpart of this gene suggested that this kinase play a key role in T cell proliferation, apoptosis and differentiation. Five alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jun 2013].Transcript Variant: This variant (JNK1-b1) uses a different acceptor splice site in the last coding exon compared to transcript variant JNK1-b2, resulting in a frameshift and a shorter isoform (JNK1 beta1) with a different C-terminus, compared to isoform JNK1 beta2. The JNK1-b1 variant differs from the JNK1-a1 variant in the use of an alternate internal coding exon of the same length. Thus, JNK1 beta1 isoform is the same length as JNK1 alpha1 isoform, with a few aa difference in an internal protein segment.
-
NCBI Accession
- NM_139046, NP_620634
Target
-