Human MCL1 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human MCL1 cDNA Clone in Mammalian Expression Vector (ABIN3378856)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc315538
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human MCL1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2400 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "FBXW7 mediates chemotherapeutic sensitivity and prognosis in NSCLCs." in: Molecular cancer research : MCR, Vol. 12, Issue 1, pp. 32-7, (2014) (PubMed).
: "Targeting acute myeloid leukemia by dual inhibition of PI3K signaling and Cdk9-mediated Mcl-1 transcription." in: Blood, Vol. 122, Issue 5, pp. 738-48, (2013) (PubMed).
: "Overexpression of Mcl-1 confers multidrug resistance, whereas topoisomerase IIβ downregulation introduces mitoxantrone-specific drug resistance in acute myeloid leukemia." in: Molecular pharmacology, Vol. 84, Issue 2, pp. 236-43, (2013) (PubMed).
: "N-α-acetyltransferase 10 protein inhibits apoptosis through RelA/p65-regulated MCL1 expression." in: Carcinogenesis, Vol. 33, Issue 6, pp. 1193-202, (2012) (PubMed).
: "Sorafenib decreases proliferation and induces apoptosis of prostate cancer cells by inhibition of the androgen receptor and Akt signaling pathways." in: Endocrine-related cancer, Vol. 19, Issue 3, pp. 305-19, (2012) (PubMed).
: "Mitogen-activated protein kinase inhibition induces translocation of Bmf to promote apoptosis in melanoma." in: Cancer research, Vol. 69, Issue 5, pp. 1985-94, (2009) (PubMed).
-
-
- MCL-1 (MCL1) (Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1))
-
Alternative Name
- MCL1
-
Background
- This gene encodes an anti-apoptotic protein, which is a member of the Bcl-2 family. Alternative splicing results in multiple transcript variants. The longest gene product (isoform 1) enhances cell survival by inhibiting apoptosis while the alternatively spliced shorter gene products (isoform 2 and isoform 3) promote apoptosis and are death-inducing. [provided by RefSeq, Oct 2010].Transcript Variant: This variant (1), also known as MCL-1L (long), represents the longest transcript and encodes the longest isoform (1).
-
NCBI Accession
- NM_021960, NP_068779
Target
-