Human MCL1 cDNA Clone in Mammalian Expression Vector
This is a Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 plasmid from OriGene - 6 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 2400 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(6 references)
Catalog No. ABIN3378856
Supplier Product No.: sc315538
$679.14
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human MCL1 cDNA Clone in Mammalian Expression Vector (ABIN3378856)
Gene
MCL-1 (MCL1)
(Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL4
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc315538
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human MCL1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2400 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "FBXW7 mediates chemotherapeutic sensitivity and prognosis in NSCLCs." in: Molecular cancer research : MCR, Vol. 12, Issue 1, pp. 32-7, (2014) (PubMed).
: "Targeting acute myeloid leukemia by dual inhibition of PI3K signaling and Cdk9-mediated Mcl-1 transcription." in: Blood, Vol. 122, Issue 5, pp. 738-48, (2013) (PubMed).
: "Overexpression of Mcl-1 confers multidrug resistance, whereas topoisomerase IIβ downregulation introduces mitoxantrone-specific drug resistance in acute myeloid leukemia." in: Molecular pharmacology, Vol. 84, Issue 2, pp. 236-43, (2013) (PubMed).
: "N-α-acetyltransferase 10 protein inhibits apoptosis through RelA/p65-regulated MCL1 expression." in: Carcinogenesis, Vol. 33, Issue 6, pp. 1193-202, (2012) (PubMed).
: "Sorafenib decreases proliferation and induces apoptosis of prostate cancer cells by inhibition of the androgen receptor and Akt signaling pathways." in: Endocrine-related cancer, Vol. 19, Issue 3, pp. 305-19, (2012) (PubMed).
: "Mitogen-activated protein kinase inhibition induces translocation of Bmf to promote apoptosis in melanoma." in: Cancer research, Vol. 69, Issue 5, pp. 1985-94, (2009) (PubMed).
-
-
- MCL-1 (MCL1) (Induced Myeloid Leukemia Cell Differentiation Protein Mcl-1 (MCL1))
-
Alternative Name
- MCL1
-
Background
- This gene encodes an anti-apoptotic protein, which is a member of the Bcl-2 family. Alternative splicing results in multiple transcript variants. The longest gene product (isoform 1) enhances cell survival by inhibiting apoptosis while the alternatively spliced shorter gene products (isoform 2 and isoform 3) promote apoptosis and are death-inducing. [provided by RefSeq, Oct 2010].Transcript Variant: This variant (1), also known as MCL-1L (long), represents the longest transcript and encodes the longest isoform (1).
-
NCBI Accession
- NM_021960, NP_068779
Target
-
You are here:
