Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human MKNK2 cDNA Clone in Mammalian Expression Vector

This is a MAP Kinase Interacting serine/threonine Kinase 2 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 1400 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3378911
Supplier Product No.: sc315549
$679.14
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 21 to 22 Business Days

Quick Overview for Human MKNK2 cDNA Clone in Mammalian Expression Vector (ABIN3378911)

Gene

MKNK2 (MAP Kinase Interacting serine/threonine Kinase 2 (MKNK2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc315549

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human MKNK2 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1400 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    MKNK2 (MAP Kinase Interacting serine/threonine Kinase 2 (MKNK2))

    Alternative Name

    MKNK2

    Background

    This gene encodes a member of the calcium/calmodulin-dependent protein kinases (CAMK) Ser/Thr protein kinase family, which belongs to the protein kinase superfamily. This protein contains conserved DLG (asp-leu-gly) and ENIL (glu-asn-ile-leu) motifs, and an N-terminal polybasic region which binds importin A and the translation factor scaffold protein eukaryotic initiation factor 4G (eIF4G). This protein is one of the downstream kinases activated by mitogen-activated protein (MAP) kinases. It phosphorylates the eukaryotic initiation factor 4E (eIF4E), thus playing important roles in the initiation of mRNA translation, oncogenic transformation and malignant cell proliferation. In addition to eIF4E, this protein also interacts with von Hippel-Lindau tumor suppressor (VHL), ring-box 1 (Rbx1) and Cullin2 (Cul2), which are all components of the CBC(VHL) ubiquitin ligase E3 complex. Multiple alternatively spliced transcript variants have been found, but the full-length nature and biological activity of only two variants are determined. These two variants encode distinct isoforms which differ in activity and regulation, and in subcellular localization. [provided by RefSeq, Aug 2011].Transcript Variant: This variant (1) differs in the 3' exon including 3' coding region and 3' UTR, compared to variant 2. The resulting protein (isoform 1, also known as isoform b) has a shorter and distinct C-terminus, compared to isoform 2. This isoform is found in the nucleus and lacks the MAP kinase-binding region.

    NCBI Accession

    NM_017572, NP_060042
You are here: