Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human MYCN cDNA Clone in Mammalian Expression Vector

This is a N-Myc Proto-Oncogene Protein plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 2600 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3379034
Supplier Product No.: sc116780
$679.14
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human MYCN cDNA Clone in Mammalian Expression Vector (ABIN3379034)

Gene

MYCN (N-Myc Proto-Oncogene Protein (MYCN))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc116780

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human MYCN is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2600 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Ruiz-Pérez, Medina, Urdiales, Keinänen, Sánchez-Jiménez: "Polyamine metabolism is sensitive to glycolysis inhibition in human neuroblastoma cells." in: The Journal of biological chemistry, Vol. 290, Issue 10, pp. 6106-19, (2015) (PubMed).

    Wang, Gu, Huang, Chen, Zhang, Xu: "Inhibition of autophagy potentiates the efficacy of Gli inhibitor GANT-61 in MYCN-amplified neuroblastoma cells." in: BMC cancer, Vol. 14, pp. 768, (2014) (PubMed).

    Izumi, Kaneko: "Evidence of asymmetric cell division and centrosome inheritance in human neuroblastoma cells." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 109, Issue 44, pp. 18048-53, (2012) (PubMed).

    Kang, Rychahou, Ishola, Mourot, Evers, Chung: "N-myc is a novel regulator of PI3K-mediated VEGF expression in neuroblastoma." in: Oncogene, Vol. 27, Issue 28, pp. 3999-4007, (2008) (PubMed).

  • Target

    MYCN (N-Myc Proto-Oncogene Protein (MYCN))

    Alternative Name

    MYCN

    Background

    This gene is a member of the MYC family and encodes a protein with a basic helix-loop-helix (bHLH) domain. This protein is located in the nucleus and must dimerize with another bHLH protein in order to bind DNA. Amplification of this gene is associated with a variety of tumors, most notably neuroblastomas. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014].Transcript Variant: This variant (2) lacks segment 1b in the 5' region, compared to variant 1. This variant includes two open reading frames, the isoform 1 represented by this RefSeq is translated from the downstream open reading frame. This transcript and variant 1 encode the same isoform 1.

    NCBI Accession

    NM_005378, NP_005369
You are here: