Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human NFATC1 cDNA Clone in Mammalian Expression Vector

This is a Nuclear Factor of Activated T-Cells, Cytoplasmic, Calcineurin-Dependent 1 plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 3250 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3379109
Supplier Product No.: sc109490
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human NFATC1 cDNA Clone in Mammalian Expression Vector (ABIN3379109)

Gene

NFATC1 (Nuclear Factor of Activated T-Cells, Cytoplasmic, Calcineurin-Dependent 1 (NFATC1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc109490

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human NFATC1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3250 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Murray, Wong, Vrankova, Rigas: "Phospho-sulindac inhibits pancreatic cancer growth: NFATc1 as a drug resistance candidate." in: International journal of oncology, Vol. 44, Issue 2, pp. 521-9, (2013) (PubMed).

  • Target

    NFATC1 (Nuclear Factor of Activated T-Cells, Cytoplasmic, Calcineurin-Dependent 1 (NFATC1))

    Alternative Name

    NFATC1

    Background

    The product of this gene is a component of the nuclear factor of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation, and an inducible nuclear component. Proteins belonging to this family of transcription factors play a central role in inducible gene transcription during immune response. The product of this gene is an inducible nuclear component. It functions as a major molecular target for the immunosuppressive drugs such as cyclosporin A. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Different isoforms of this protein may regulate inducible expression of different cytokine genes. [provided by RefSeq, Jul 2013].Transcript Variant: This variant (4) lacks an internal exon in the 5' region, which results in a downstream translation start codon, and has an alternate splice site in the 3' coding region, compared to variant 6. The encoded isoform (D) is shorter at both the N- and C- termini, compared to isoform F.

    NCBI Accession

    NM_172388, NP_765976
You are here: