Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human NFKB1 cDNA Clone in Mammalian Expression Vector

This is a Nuclear Factor of kappa Light Polypeptide Gene Enhancer in B-Cells 1 plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 3800 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3379112
Supplier Product No.: sc327682
$1,316.70
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human NFKB1 cDNA Clone in Mammalian Expression Vector (ABIN3379112)

Gene

NFKB1 (Nuclear Factor of kappa Light Polypeptide Gene Enhancer in B-Cells 1 (NFKB1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc327682

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human NFKB1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3800 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Boopathi, Hypolite, Zderic, Gomes, Malkowicz, Liou, Wein, Chacko: "GATA-6 and NF-κB activate CPI-17 gene transcription and regulate Ca2+ sensitization of smooth muscle contraction." in: Molecular and cellular biology, Vol. 33, Issue 5, pp. 1085-102, (2013) (PubMed).

  • Target

    NFKB1 (Nuclear Factor of kappa Light Polypeptide Gene Enhancer in B-Cells 1 (NFKB1))

    Alternative Name

    NFKB1

    Background

    This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Inappropriate activation of NFKB has been associated with a number of inflammatory diseases while persistent inhibition of NFKB leads to inappropriate immune cell development or delayed cell growth. Alternative splicing results in multiple transcript variants encoding different isoforms, at least one of which is proteolytically processed. [provided by RefSeq, Feb 2016].Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is 1 aa shorter compared to isoform 1.

    NCBI Accession

    NM_001165412, NP_001158884
You are here: