Human VND cDNA Clone in Mammalian Expression Vector
(2 references)
Quick Overview for Human VND cDNA Clone in Mammalian Expression Vector (ABIN3379124)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc118030
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human NKX2 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2300 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
![Human VND ORF Clone in Lenti Particles (GFP tag)]()
Human VND ORF Clone in Lenti Particles (GFP tag)ORF PExp Lentiviral Vector pLenti-C-mGFP Chloramphenicol CMV Promoter GFP tag Transient
![Human VND ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)]()
Human VND ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
![Human VND ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)]()
Human VND ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
![Human VND ORF Clone in Lenti Particles (GFP tag)]()
Human VND ORF Clone in Lenti Particles (GFP tag)ORF PExp Lentiviral Vector pLenti-C-mGFP Chloramphenicol CMV Promoter GFP tag Transient
![Human VND ORF Clone in Lenti Particles (GFP tag)]()
Human VND ORF Clone in Lenti Particles (GFP tag)ORF PExp Lentiviral Vector pLenti-C-mGFP Chloramphenicol CMV Promoter GFP tag Transient
![Human VND ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)]()
Human VND ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
![Human VND ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)]()
Human VND ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
![Human VND ORF Clone in Lenti Particles (GFP tag)]()
Human VND ORF Clone in Lenti Particles (GFP tag)ORF PExp Lentiviral Vector pLenti-C-mGFP Chloramphenicol CMV Promoter GFP tag Transient
![Human VND ORF Clone in Lenti Particles (GFP tag)]()
Human VND ORF Clone in Lenti Particles (GFP tag)ORF PExp Lentiviral Vector pLenti-C-mGFP Chloramphenicol CMV Promoter GFP tag Transient
![Human VND ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)]()
Human VND ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "CCSP G38A polymorphism environment interactions regulate CCSP levels differentially in COPD." in: American journal of physiology. Lung cellular and molecular physiology, Vol. 311, Issue 4, pp. L696-L703, (2016) (PubMed).
: "Integrative Genomics Implicates EGFR as a Downstream Mediator in NKX2-1 Amplified Non-Small Cell Lung Cancer." in: PLoS ONE, Vol. 10, Issue 11, pp. e0142061, (2015) (PubMed).
-
-
- NKX2 (VND) (Ventral Nervous System Defective (VND))
-
Alternative Name
- NKX2
-
Background
- This gene encodes a protein initially identified as a thyroid-specific transcription factor. The encoded protein binds to the thyroglobulin promoter and regulates the expression of thyroid-specific genes but has also been shown to regulate the expression of genes involved in morphogenesis. Mutations and deletions in this gene are associated with benign hereditary chorea, choreoathetosis, congenital hypothyroidism, and neonatal respiratory distress, and may be associated with thyroid cancer. Multiple transcript variants encoding different isoforms have been found for this gene. This gene shares the symbol/alias 'TTF1' with another gene, transcription termination factor 1, which plays a role in ribosomal gene transcription. [provided by RefSeq, Feb 2014].Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct N-terminus compared to isoform 1.
-
NCBI Accession
- NM_003317, NP_003308
Target
-
