Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human NPC1 cDNA Clone in Mammalian Expression Vector

This is a Niemann-Pick Disease, Type C1 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 4800 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3379148
Supplier Product No.: sc120010
$1,653.30
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human NPC1 cDNA Clone in Mammalian Expression Vector (ABIN3379148)

Gene

NPC1 (Niemann-Pick Disease, Type C1 (NPC1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc120010

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human NPC1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4800 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Podechard, Le Ferrec, Rebillard, Fardel, Lecureur: "NPC1 repression contributes to lipid accumulation in human macrophages exposed to environmental aryl hydrocarbons." in: Cardiovascular research, Vol. 82, Issue 2, pp. 361-70, (2009) (PubMed).

    Tang, Leao, Coleman, Broughton, Hildreth: "Deficiency of niemann-pick type C-1 protein impairs release of human immunodeficiency virus type 1 and results in Gag accumulation in late endosomal/lysosomal compartments." in: Journal of virology, Vol. 83, Issue 16, pp. 7982-95, (2009) (PubMed).

    Infante, Abi-Mosleh, Radhakrishnan, Dale, Brown, Goldstein: "Purified NPC1 protein. I. Binding of cholesterol and oxysterols to a 1278-amino acid membrane protein." in: The Journal of biological chemistry, Vol. 283, Issue 2, pp. 1052-63, (2008) (PubMed).

  • Target

    NPC1 (Niemann-Pick Disease, Type C1 (NPC1))

    Alternative Name

    NPC1

    Background

    This gene encodes a large protein that resides in the limiting membrane of endosomes and lysosomes and mediates intracellular cholesterol trafficking via binding of cholesterol to its N-terminal domain. It is predicted to have a cytoplasmic C-terminus, 13 transmembrane domains, and 3 large loops in the lumen of the endosome - the last loop being at the N-terminus. This protein transports low-density lipoproteins to late endosomal/lysosomal compartments where they are hydrolized and released as free cholesterol. Defects in this gene cause Niemann-Pick type C disease, a rare autosomal recessive neurodegenerative disorder characterized by over accumulation of cholesterol and glycosphingolipids in late endosomal/lysosomal compartments.[provided by RefSeq, Aug 2009].

    NCBI Accession

    NM_000271, NP_000262
You are here: