Human NR1I2 cDNA Clone in Mammalian Expression Vector
This is a Nuclear Receptor Subfamily 1, Group I, Member 2 plasmid from OriGene - 7 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 2930 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(7 references)
Catalog No. ABIN3379160
Supplier Product No.: sc109997
$452.43
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human NR1I2 cDNA Clone in Mammalian Expression Vector (ABIN3379160)
Gene
NR1I2
(Nuclear Receptor Subfamily 1, Group I, Member 2 (NR1I2))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL4
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc109997
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human NR1I2 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2930 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Cross-talk between EPAS-1/HIF-2α and PXR signaling pathway regulates multi-drug resistance of stomach cancer cell." in: The international journal of biochemistry & cell biology, Vol. 72, pp. 73-88, (2016) (PubMed).
: "Bortezomib and ixazomib protect firefly luciferase from degradation and can flaw respective reporter gene assays." in: Analytical biochemistry, Vol. 509, pp. 124-9, (2016) (PubMed).
: "Desmethyl bosentan displays a similar in vitro interaction profile as bosentan." in: Pulmonary pharmacology & therapeutics, Vol. 30, pp. 80-6, (2015) (PubMed).
: "Obatoclax as a perpetrator in drug-drug interactions and its efficacy in multidrug resistance cell lines." in: The Journal of pharmacy and pharmacology, Vol. 67, Issue 11, pp. 1575-84, (2015) (PubMed).
: "3-Hydroxyflavone and structural analogues differentially activate pregnane X receptor: Implication for inflammatory bowel disease." in: Pharmacological research, Vol. 100, pp. 64-72, (2015) (PubMed).
: "Pharmacokinetic interaction profile of riociguat, a new soluble guanylate cyclase stimulator, in vitro." in: Pulmonary pharmacology & therapeutics, Vol. 28, Issue 2, pp. 130-7, (2014) (PubMed).
: "Induced CYP3A4 expression in confluent Huh7 hepatoma cells as a result of decreased cell proliferation and subsequent pregnane X receptor activation." in: Molecular pharmacology, Vol. 83, Issue 3, pp. 659-70, (2013) (PubMed).
-
-
- NR1I2 (Nuclear Receptor Subfamily 1, Group I, Member 2 (NR1I2))
-
Alternative Name
- NR1I2
-
Background
- This gene product belongs to the nuclear receptor superfamily, members of which are transcription factors characterized by a ligand-binding domain and a DNA-binding domain. The encoded protein is a transcriptional regulator of the cytochrome P450 gene CYP3A4, binding to the response element of the CYP3A4 promoter as a heterodimer with the 9-cis retinoic acid receptor RXR. It is activated by a range of compounds that induce CYP3A4, including dexamethasone and rifampicin. Several alternatively spliced transcripts encoding different isoforms, some of which use non-AUG (CUG) translation initiation codon, have been described for this gene. Additional transcript variants exist, however, they have not been fully characterized. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) contains an alternate 5' terminal exon compared to transcript variant 2, and initiates translation from an in-frame, downstream non-AUG (CUG) codon, resulting in a shorter isoform (1) with a different N-terminus compared to isoform 2.
-
NCBI Accession
- NM_003889, NP_003880
Target
-
You are here:
