Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human P4HB cDNA Clone in Mammalian Expression Vector

This is a Prolyl 4-Hydroxylase, beta Polypeptide plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL4. Insert length: 2700 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3379256
Supplier Product No.: sc119620
$703.89
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human P4HB cDNA Clone in Mammalian Expression Vector (ABIN3379256)

Gene

P4HB (Prolyl 4-Hydroxylase, beta Polypeptide (P4HB))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL4

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc119620

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human P4HB is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2700 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Vatolin, Phillips, Jha, Govindgari, Hu, Grabowski, Parker, Lindner, Zhong, Distelhorst, Smith, Cotta, Xu, Chilakala, Kuang, Tall, Reu: "Novel Protein Disulfide Isomerase Inhibitor with Anticancer Activity in Multiple Myeloma." in: Cancer research, Vol. 76, Issue 11, pp. 3340-50, (2016) (PubMed).

    Zhao, Lu, Li: "Proapoptotic activities of protein disulfide isomerase (PDI) and PDIA3 protein, a role of the Bcl-2 protein Bak." in: The Journal of biological chemistry, Vol. 290, Issue 14, pp. 8949-63, (2015) (PubMed).

    Lee, Sun, Ho, Kiang, Zhang, Xu, Leung: "Hyperoxia resensitizes chemoresistant glioblastoma cells to temozolomide through unfolded protein response." in: Anticancer research, Vol. 34, Issue 6, pp. 2957-66, (2014) (PubMed).

    Pybus, Dean, West, Smith, Daramola, Field, Wilkinson, James: "Model-directed engineering of "difficult-to-express" monoclonal antibody production by Chinese hamster ovary cells." in: Biotechnology and bioengineering, Vol. 111, Issue 2, pp. 372-85, (2014) (PubMed).

  • Target

    P4HB (Prolyl 4-Hydroxylase, beta Polypeptide (P4HB))

    Alternative Name

    P4HB

    Background

    This gene encodes the beta subunit of prolyl 4-hydroxylase, a highly abundant multifunctional enzyme that belongs to the protein disulfide isomerase family. When present as a tetramer consisting of two alpha and two beta subunits, this enzyme is involved in hydroxylation of prolyl residues in preprocollagen. This enzyme is also a disulfide isomerase containing two thioredoxin domains that catalyze the formation, breakage and rearrangement of disulfide bonds. Other known functions include its ability to act as a chaperone that inhibits aggregation of misfolded proteins in a concentration-dependent manner, its ability to bind thyroid hormone, its role in both the influx and efflux of S-nitrosothiol-bound nitric oxide, and its function as a subunit of the microsomal triglyceride transfer protein complex. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_000918, NP_000909
You are here: