Human PD-L1 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human PD-L1 cDNA Clone in Mammalian Expression Vector (ABIN3379329)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc115168
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human PD-L1 / CD274 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 4000 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Human CAR T cells with cell-intrinsic PD-1 checkpoint blockade resist tumor-mediated inhibition." in: The Journal of clinical investigation, Vol. 126, Issue 8, pp. 3130-44, (2016) (PubMed).
: "MiR-570 inhibited the cell proliferation and invasion through directly targeting B7-H1 in hepatocellular carcinoma." in: Tumour biology, Vol. 36, Issue 11, pp. 9049-57, (2015) (PubMed).
-
: "Human CAR T cells with cell-intrinsic PD-1 checkpoint blockade resist tumor-mediated inhibition." in: The Journal of clinical investigation, Vol. 126, Issue 8, pp. 3130-44, (2016) (PubMed).
-
- PD-L1 (CD274 (PD-L1))
-
Alternative Name
- PD-L1 / CD274
-
Background
- This gene encodes an immune inhibitory receptor ligand that is expressed by hematopoietic and non-hematopoietic cells, such as T cells and B cells and various types of tumor cells. The encoded protein is a type I transmembrane protein that has immunoglobulin V-like and C-like domains. Interaction of this ligand with its receptor inhibits T-cell activation and cytokine production. During infection or inflammation of normal tissue, this interaction is important for preventing autoimmunity by maintaining homeostasis of the immune response. In tumor microenvironments, this interaction provides an immune escape for tumor cells through cytotoxic T-cell inactivation. Expression of this gene in tumor cells is considered to be prognostic in many types of human malignancies, including colon cancer and renal cell carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015].Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a).
-
NCBI Accession
- NM_014143, NP_054862
Target
-